Transcript: Mouse NM_153152.3

Mus musculus RIKEN cDNA 2410015M20 gene (2410015M20Rik), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
2410015M20Rik (224904)
Length:
755
CDS:
104..463

Additional Resources:

NCBI RefSeq record:
NM_153152.3
NBCI Gene record:
2410015M20Rik (224904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328885 ATGTACCAGTTCAGCCAATAT pLKO_005 257 CDS 100% 13.200 10.560 N 2410015M20Rik n/a
2 TRCN0000178674 CCCAATAAAGGACTTGGGAAT pLKO.1 562 3UTR 100% 0.405 0.324 N 2410015M20Rik n/a
3 TRCN0000328951 CCCAATAAAGGACTTGGGAAT pLKO_005 562 3UTR 100% 0.405 0.324 N 2410015M20Rik n/a
4 TRCN0000181755 GCCCAATAAAGGACTTGGGAA pLKO.1 561 3UTR 100% 0.264 0.211 N 2410015M20Rik n/a
5 TRCN0000328886 ATTTCCAAACTTCCGTGATTC pLKO_005 334 CDS 100% 10.800 7.560 N 2410015M20Rik n/a
6 TRCN0000181512 GAGGAGCAGTCTACCTTGTTT pLKO.1 159 CDS 100% 5.625 3.938 N 2410015M20Rik n/a
7 TRCN0000328950 GAGGAGCAGTCTACCTTGTTT pLKO_005 159 CDS 100% 5.625 3.938 N 2410015M20Rik n/a
8 TRCN0000181251 CACCAGCAATGTACCAGTTCA pLKO.1 249 CDS 100% 4.950 3.465 N 2410015M20Rik n/a
9 TRCN0000176640 CCTCCAAAGATTAAATTTCCA pLKO.1 320 CDS 100% 3.000 2.100 N 2410015M20Rik n/a
10 TRCN0000178148 GTTCCTCATTAAGGGAAGTGT pLKO.1 133 CDS 100% 3.000 2.100 N 2410015M20Rik n/a
11 TRCN0000181276 CAATATGTGTGCCAGCAGACA pLKO.1 272 CDS 100% 2.640 1.848 N 2410015M20Rik n/a
12 TRCN0000181582 GCAATGTACCAGTTCAGCCAA pLKO.1 254 CDS 100% 2.640 1.848 N 2410015M20Rik n/a
13 TRCN0000198812 CTTGTTTATGACCAGGAGCTG pLKO.1 173 CDS 100% 2.160 1.512 N 2410015M20Rik n/a
14 TRCN0000181329 CTCATTAAGGGAAGTGTGGCT pLKO.1 137 CDS 100% 0.660 0.462 N 2410015M20Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04804 pDONR223 100% 84.3% 86.5% None (many diffs) n/a
2 ccsbBroad304_04804 pLX_304 0% 84.3% 86.5% V5 (many diffs) n/a
3 TRCN0000477647 TTATAATTGTTTCACCTCCCCCGT pLX_317 100% 84.3% 86.5% V5 (many diffs) n/a
Download CSV