Transcript: Mouse NM_153168.3

Mus musculus leucyl-tRNA synthetase, mitochondrial (Lars2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Lars2 (102436)
Length:
3905
CDS:
200..2908

Additional Resources:

NCBI RefSeq record:
NM_153168.3
NBCI Gene record:
Lars2 (102436)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076061 CCAGAGTGGTACGGAATCAAA pLKO.1 974 CDS 100% 5.625 7.875 N Lars2 n/a
2 TRCN0000076060 GCCTCATTAAGGGACAGACAT pLKO.1 1986 CDS 100% 4.950 6.930 N Lars2 n/a
3 TRCN0000076059 CGTGACAAGTAACAAGCTGAA pLKO.1 1510 CDS 100% 4.050 3.240 N Lars2 n/a
4 TRCN0000437096 GCAAGCTCTGTGACCATTATG pLKO_005 2619 CDS 100% 13.200 9.240 N Lars2 n/a
5 TRCN0000433343 GTCTGAAGAAGGAGGATATAG pLKO_005 2028 CDS 100% 13.200 9.240 N Lars2 n/a
6 TRCN0000438579 ATGAGAGGCATGCAGGTTATC pLKO_005 545 CDS 100% 10.800 7.560 N Lars2 n/a
7 TRCN0000076062 CCTCATGTAACCTCAGAACTT pLKO.1 2573 CDS 100% 4.950 3.465 N Lars2 n/a
8 TRCN0000076058 CCTATCATTGTGAAGCAGAAT pLKO.1 3261 3UTR 100% 4.950 2.475 Y Lars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07876 pDONR223 100% 85% 86.4% None (many diffs) n/a
2 ccsbBroad304_07876 pLX_304 0% 85% 86.4% V5 (many diffs) n/a
3 TRCN0000480082 TACTTTCGGATAGACCTTCCAGAA pLX_317 16.3% 85% 86.4% V5 (many diffs) n/a
Download CSV