Transcript: Mouse NM_153178.4

Mus musculus argonaute RISC catalytic subunit 2 (Ago2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ago2 (239528)
Length:
8031
CDS:
166..2748

Additional Resources:

NCBI RefSeq record:
NM_153178.4
NBCI Gene record:
Ago2 (239528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153178.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009630 CCTATCCAATCTCTGCTTAAA pLKO.1 1845 CDS 100% 13.200 10.560 N Ago2 n/a
2 TRCN0000433524 ACAGATTCCCAAAGGGTAAAG pLKO_005 919 CDS 100% 10.800 7.560 N AGO2 n/a
3 TRCN0000255787 ACGTGCTTTGGGATGACAATC pLKO_005 2465 CDS 100% 10.800 7.560 N Ago2 n/a
4 TRCN0000265701 CTGATGCGAAGTGCAAGTTTC pLKO_005 1312 CDS 100% 10.800 7.560 N Ago2 n/a
5 TRCN0000255784 TGGTACGAGAGTTGCTCATTC pLKO_005 2102 CDS 100% 10.800 7.560 N Ago2 n/a
6 TRCN0000009633 ACAATCAAACTACAGGCCAAT pLKO.1 277 CDS 100% 4.050 2.835 N Ago2 n/a
7 TRCN0000255785 CACAGCCAGTGATCGAGTTTG pLKO_005 848 CDS 100% 10.800 6.480 N Ago2 n/a
8 TRCN0000009632 CAAAGGGTAAAGTTTACCAAA pLKO.1 928 CDS 100% 4.950 2.970 N Ago2 n/a
9 TRCN0000009634 AGAAGGACTATCAGCCAGGAA pLKO.1 2252 CDS 100% 2.640 1.584 N Ago2 n/a
10 TRCN0000255786 ATCGAACATGAGACGTCTTTG pLKO_005 2846 3UTR 100% 10.800 5.400 Y Ago2 n/a
11 TRCN0000009631 GAAGGCAAAGATCGCATCTTA pLKO.1 532 CDS 100% 5.625 3.938 N Ago2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153178.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11851 pDONR223 100% 61.4% 68% None (many diffs) n/a
2 ccsbBroad304_11851 pLX_304 0% 61.4% 68% V5 (many diffs) n/a
3 TRCN0000468477 CTGAAGCTCCACCCAAAAACGCGC pLX_317 14.7% 61.4% 68% V5 (many diffs) n/a
4 ccsbBroadEn_11852 pDONR223 100% 39.1% 43.8% None (many diffs) n/a
5 ccsbBroad304_11852 pLX_304 0% 39.1% 43.8% V5 (many diffs) n/a
Download CSV