Transcript: Mouse NM_153196.1

Mus musculus ribokinase (Rbks), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Rbks (71336)
Length:
1047
CDS:
10..981

Additional Resources:

NCBI RefSeq record:
NM_153196.1
NBCI Gene record:
Rbks (71336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078933 GCCTCCATAATTGTCAATAAT pLKO.1 337 CDS 100% 15.000 21.000 N Rbks n/a
2 TRCN0000078936 GTGATGATATGCCAGCTAGAA pLKO.1 454 CDS 100% 4.950 6.930 N Rbks n/a
3 TRCN0000078934 TCAATAATGAAGGCCAGAATA pLKO.1 350 CDS 100% 13.200 9.240 N Rbks n/a
4 TRCN0000078937 TGATGATATGCCAGCTAGAAA pLKO.1 455 CDS 100% 5.625 3.938 N Rbks n/a
5 TRCN0000078935 CCAAAGCACATTCCCACTGAA pLKO.1 763 CDS 100% 4.950 3.465 N Rbks n/a
6 TRCN0000195544 CATAGTGGCTGGAGCAAATTT pLKO.1 378 CDS 100% 15.000 21.000 N RBKS n/a
7 TRCN0000279958 CATAGTGGCTGGAGCAAATTT pLKO_005 378 CDS 100% 15.000 21.000 N RBKS n/a
8 TRCN0000199478 GCCTTCTACCTGGCTTACTAT pLKO.1 838 CDS 100% 5.625 3.938 N RBKS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487710 CAAGATAAGCGTCGGCCCTTGGTC pLX_317 23.5% 85.4% 86% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_03917 pDONR223 100% 85.3% 86% None (many diffs) n/a
3 ccsbBroad304_03917 pLX_304 0% 85.3% 86% V5 (many diffs) n/a
4 TRCN0000471252 CTCAGGCCATGTATTGCCCTAGCC pLX_317 40.8% 85.3% 86% V5 (many diffs) n/a
5 ccsbBroadEn_15130 pDONR223 0% 85.3% 86% None (many diffs) n/a
6 ccsbBroad304_15130 pLX_304 0% 85.3% 86% V5 (many diffs) n/a
7 TRCN0000465506 AACGAACAACTGCCAGGCCTATTC pLX_317 22.9% 85.3% 86% V5 (many diffs) n/a
8 TRCN0000487709 AACACATCACCCTCCGACACTGCC pLX_317 23.5% 85.3% 86% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489586 TCGTCCTTCCAATCCCGCGTAAGT pLX_317 22.3% 85.2% 85.8% V5 (many diffs) n/a
Download CSV