Transcript: Human NM_153249.1

Homo sapiens coiled-coil domain containing 186 (CCDC186), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CCDC186 (55088)
Length:
2085
CDS:
393..1028

Additional Resources:

NCBI RefSeq record:
NM_153249.1
NBCI Gene record:
CCDC186 (55088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153249.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153249.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15886 pDONR223 0% 99.8% 100% None 120T>C n/a
2 ccsbBroad304_15886 pLX_304 0% 99.8% 100% V5 120T>C n/a
3 TRCN0000471301 TTCTACGAGTCTAGTGTCTACCCC pLX_317 75.3% 99.8% 100% V5 120T>C n/a
4 ccsbBroadEn_03519 pDONR223 100% 23.4% 23.4% None 633_634ins2061 n/a
5 ccsbBroad304_03519 pLX_304 0% 23.4% 23.4% V5 633_634ins2061 n/a
6 TRCN0000473338 TTTTCCTGATGTTTTGTGGGTGTG pLX_317 18.6% 23.4% 23.4% V5 633_634ins2061 n/a
Download CSV