Transcript: Human NM_153337.3

Homo sapiens sorting nexin 20 (SNX20), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SNX20 (124460)
Length:
3263
CDS:
133..522

Additional Resources:

NCBI RefSeq record:
NM_153337.3
NBCI Gene record:
SNX20 (124460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244601 AGCACGTCAAACTGCTCTTTG pLKO_005 347 CDS 100% 10.800 7.560 N SNX20 n/a
2 TRCN0000315393 GTACTGGCAGAACCAGAAATG pLKO_005 318 CDS 100% 10.800 7.560 N SNX20 n/a
3 TRCN0000180832 GCACGTCAAACTGCTCTTTGA pLKO.1 348 CDS 100% 0.495 0.347 N SNX20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04784 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04784 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470517 GTCGGATTACGACGGGACCCCGAT pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_09482 pDONR223 100% 77.5% 74.8% None (many diffs) n/a
5 ccsbBroad304_09482 pLX_304 0% 77.5% 74.8% V5 (many diffs) n/a
6 TRCN0000471666 CATTTGTGGGTGGAGAATGTCTAC pLX_317 100% 77.5% 74.8% V5 (many diffs) n/a
Download CSV