Transcript: Mouse NM_153534.2

Mus musculus adenylate cyclase 2 (Adcy2), mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Mus musculus (mouse)
Gene:
Adcy2 (210044)
Length:
4211
CDS:
247..3534

Additional Resources:

NCBI RefSeq record:
NM_153534.2
NBCI Gene record:
Adcy2 (210044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437612 CTGTAATAGCTGGCGTCATAG pLKO_005 3272 CDS 100% 10.800 15.120 N Adcy2 n/a
2 TRCN0000110772 CGAGCGTCAATACATGCACAT pLKO.1 3147 CDS 100% 4.050 5.670 N Adcy2 n/a
3 TRCN0000110771 CGGTGAGATAAGAGACCCATA pLKO.1 1593 CDS 100% 4.050 3.240 N Adcy2 n/a
4 TRCN0000417374 TGTGCCAATGGGTCAACATAA pLKO_005 1839 CDS 100% 13.200 9.240 N Adcy2 n/a
5 TRCN0000110774 CGAAGTTCAGTGGCGTTGAAA pLKO.1 3047 CDS 100% 5.625 3.938 N Adcy2 n/a
6 TRCN0000110770 CCTAAGCAGAAGGAGAAGGAA pLKO.1 3740 3UTR 100% 3.000 2.100 N Adcy2 n/a
7 TRCN0000110773 GCCATAAAGAAAGTGAGGGAT pLKO.1 1360 CDS 100% 2.640 1.848 N Adcy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05772 pDONR223 100% 88.1% 95.1% None (many diffs) n/a
2 ccsbBroad304_05772 pLX_304 0% 88.1% 95.1% V5 (many diffs) n/a
3 TRCN0000475864 GGGGCCGCAGTTCGCTGGTCGATC pLX_317 11.3% 88.1% 95.1% V5 (many diffs) n/a
4 TRCN0000488830 TACCGAGAAATACTCGCCGGACCT pLX_317 10.5% 87.7% 94.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489479 CGCGGCATTACAACGAGCCGGACG pLX_317 10.5% 87.7% 94.7% V5 (many diffs) n/a
Download CSV