Transcript: Mouse NM_153578.2

Mus musculus non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) (Nipa1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nipa1 (233280)
Length:
1885
CDS:
6..977

Additional Resources:

NCBI RefSeq record:
NM_153578.2
NBCI Gene record:
Nipa1 (233280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153578.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437444 GAGTACCGTTTGGGTCCATTT pLKO_005 292 CDS 100% 10.800 15.120 N Nipa1 n/a
2 TRCN0000124312 GTCGGCCAGATTGGAAACTTT pLKO.1 219 CDS 100% 5.625 7.875 N Nipa1 n/a
3 TRCN0000124309 CGGTATGTGAATCGAGTTGTT pLKO.1 1419 3UTR 100% 4.950 6.930 N Nipa1 n/a
4 TRCN0000124313 AGATTGGAAACTTTCTAGCTT pLKO.1 226 CDS 100% 3.000 4.200 N Nipa1 n/a
5 TRCN0000430402 GCATTGCCTGTGAACTAATAA pLKO_005 1068 3UTR 100% 15.000 12.000 N Nipa1 n/a
6 TRCN0000124311 GTCCTCATACAAGTGTTCAAA pLKO.1 903 CDS 100% 5.625 4.500 N Nipa1 n/a
7 TRCN0000437805 GCTTCGACTCCTCTGTATTTG pLKO_005 748 CDS 100% 13.200 9.240 N Nipa1 n/a
8 TRCN0000416234 TTAACCTAGAAGCTTTCATTC pLKO_005 1206 3UTR 100% 10.800 7.560 N Nipa1 n/a
9 TRCN0000124310 GCCATCTACTACGTTGTGTTT pLKO.1 771 CDS 100% 4.950 3.465 N Nipa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153578.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04773 pDONR223 100% 71.9% 78.6% None (many diffs) n/a
2 ccsbBroad304_04773 pLX_304 0% 71.9% 78.6% V5 (many diffs) n/a
3 TRCN0000474365 TAGACGGGCCTAACCTCCAGGAAC pLX_317 67.5% 71.9% 78.6% V5 (many diffs) n/a
Download CSV