Transcript: Human NM_170746.4

Homo sapiens selenoprotein H (SELENOH), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SELENOH (280636)
Length:
1192
CDS:
106..474

Additional Resources:

NCBI RefSeq record:
NM_170746.4
NBCI Gene record:
SELENOH (280636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_170746.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443507 GTAAAGGTGAACCCGACGAAG pLKO_005 304 CDS 100% 4.050 5.670 N SELENOH n/a
2 TRCN0000149333 GTTGTTATCGAGCATTGCACT pLKO.1 211 CDS 100% 2.640 3.696 N SELENOH n/a
3 TRCN0000424329 GCCAAACTTCAGTCATGATCC pLKO_005 548 3UTR 100% 4.050 3.240 N SELENOH n/a
4 TRCN0000180769 GCTCTGGACTGGGATTAAGAA pLKO.1 381 CDS 100% 5.625 3.938 N SELENOH n/a
5 TRCN0000128173 CCAGAAATGAAGGTTCAGTTA pLKO.1 591 3UTR 100% 4.950 3.465 N SELENOH n/a
6 TRCN0000429021 CTCTGGACTGGGATTAAGAAG pLKO_005 382 CDS 100% 4.950 3.465 N SELENOH n/a
7 TRCN0000130488 GCCAGAAATGAAGGTTCAGTT pLKO.1 590 3UTR 100% 4.950 3.465 N SELENOH n/a
8 TRCN0000437426 AGCCTTGTGGAGTTGGTAGTC pLKO_005 726 3UTR 100% 4.050 2.835 N SELENOH n/a
9 TRCN0000149530 GTTGAAGAAGTACCTGTCGTA pLKO.1 453 CDS 100% 2.640 1.848 N SELENOH n/a
10 TRCN0000180058 CCACGCAAACTCAAATTCCCT pLKO.1 409 CDS 100% 0.750 0.525 N SELENOH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170746.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05335 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05335 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000470275 GTCCGTTTAAGAACGTTTCGGCAC pLX_317 96.1% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV