Transcript: Human NM_172095.4

Homo sapiens cation channel sperm associated 2 (CATSPER2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CATSPER2 (117155)
Length:
4009
CDS:
219..1811

Additional Resources:

NCBI RefSeq record:
NM_172095.4
NBCI Gene record:
CATSPER2 (117155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172095.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424850 AGACTCACTCTTCCGATATTT pLKO_005 1697 CDS 100% 15.000 7.500 Y CATSPER2 n/a
2 TRCN0000043713 GCCACTGAAGAGGATTTAATA pLKO.1 1470 CDS 100% 15.000 7.500 Y CATSPER2 n/a
3 TRCN0000043715 GCTAGTGCGTTTCTCTATAAA pLKO.1 407 CDS 100% 15.000 7.500 Y CATSPER2 n/a
4 TRCN0000432167 GTGTCTGAAGTAGAGTCTAAT pLKO_005 1443 CDS 100% 13.200 6.600 Y CATSPER2 n/a
5 TRCN0000043716 CCACATCCTCTTCCTATTCTT pLKO.1 1561 CDS 100% 5.625 2.813 Y CATSPER2 n/a
6 TRCN0000043714 CGATCATATTGATGGTTGAAA pLKO.1 583 CDS 100% 5.625 2.813 Y CATSPER2 n/a
7 TRCN0000043717 CGGCACACTATCAGGGAGTTA pLKO.1 339 CDS 100% 4.950 2.475 Y CATSPER2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172095.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09442 pDONR223 100% 36.8% 35.9% None (many diffs) n/a
2 ccsbBroad304_09442 pLX_304 0% 36.8% 35.9% V5 (many diffs) n/a
3 TRCN0000479512 TATATGTGCACAGTCTACTCGTGT pLX_317 64.1% 36.8% 35.9% V5 (many diffs) n/a
4 ccsbBroadEn_10638 pDONR223 100% 11.5% 8.6% None (many diffs) n/a
5 ccsbBroad304_10638 pLX_304 0% 11.5% 8.6% V5 (many diffs) n/a
6 TRCN0000481464 TTTCAGTACTAATAACAGGGATCT pLX_317 100% 11.5% 8.6% V5 (many diffs) n/a
Download CSV