Transcript: Mouse NM_172120.4

Mus musculus VPS41 HOPS complex subunit (Vps41), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vps41 (218035)
Length:
3212
CDS:
25..2586

Additional Resources:

NCBI RefSeq record:
NM_172120.4
NBCI Gene record:
Vps41 (218035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172120.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349858 TCTACTTATCCACCGAATTAA pLKO_005 2193 CDS 100% 15.000 21.000 N Vps41 n/a
2 TRCN0000381899 CATCGACAAACCACCATTTAT pLKO_005 2130 CDS 100% 15.000 12.000 N Vps41 n/a
3 TRCN0000111608 CCTGTGAAGATAAACCAAATT pLKO.1 271 CDS 100% 13.200 9.240 N Vps41 n/a
4 TRCN0000312051 CCTGTGAAGATAAACCAAATT pLKO_005 271 CDS 100% 13.200 9.240 N Vps41 n/a
5 TRCN0000111607 CGACATAAGATTCTGGATATT pLKO.1 1192 CDS 100% 13.200 9.240 N Vps41 n/a
6 TRCN0000312052 CGACATAAGATTCTGGATATT pLKO_005 1192 CDS 100% 13.200 9.240 N Vps41 n/a
7 TRCN0000111609 CCACTCATCTATGAAATGATT pLKO.1 1393 CDS 100% 5.625 3.938 N Vps41 n/a
8 TRCN0000111606 CCACCGAATTAAGGAAGGAAT pLKO.1 2202 CDS 100% 4.950 3.465 N Vps41 n/a
9 TRCN0000034328 GCTTTGACAGTCAGAGGCTTT pLKO.1 982 CDS 100% 4.050 2.835 N VPS41 n/a
10 TRCN0000286984 GCTTTGACAGTCAGAGGCTTT pLKO_005 982 CDS 100% 4.050 2.835 N VPS41 n/a
11 TRCN0000349859 GAGTGGCCTGGAGATCTATAT pLKO_005 1465 CDS 100% 13.200 7.920 N Vps41 n/a
12 TRCN0000111605 GCTCTTCCCATGCCATGAAAT pLKO.1 2765 3UTR 100% 13.200 7.920 N Vps41 n/a
13 TRCN0000312106 GCTCTTCCCATGCCATGAAAT pLKO_005 2765 3UTR 100% 13.200 7.920 N Vps41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172120.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02989 pDONR223 100% 90.8% 97.1% None (many diffs) n/a
2 ccsbBroad304_02989 pLX_304 0% 90.8% 97.1% V5 (many diffs) n/a
3 TRCN0000472078 CAGTGCCTTAAGAAGGGCCGATCT pLX_317 17.7% 90.8% 97.1% V5 (many diffs) n/a
Download CSV