Transcript: Mouse NM_172257.4

Mus musculus SID1 transmembrane family, member 2 (Sidt2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Sidt2 (214597)
Length:
4239
CDS:
344..2842

Additional Resources:

NCBI RefSeq record:
NM_172257.4
NBCI Gene record:
Sidt2 (214597)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172257.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216928 CCTAATCCTTCGAGGACTATA pLKO.1 631 CDS 100% 13.200 18.480 N Sidt2 n/a
2 TRCN0000175700 GCAGCGAGAGATCAATCATAA pLKO.1 1906 CDS 100% 13.200 18.480 N Sidt2 n/a
3 TRCN0000292683 GCAGCGAGAGATCAATCATAA pLKO_005 1906 CDS 100% 13.200 18.480 N Sidt2 n/a
4 TRCN0000176311 CGTCCAGTATTTAGCCAAGTT pLKO.1 3862 3UTR 100% 4.950 6.930 N Sidt2 n/a
5 TRCN0000292684 CGTCCAGTATTTAGCCAAGTT pLKO_005 3862 3UTR 100% 4.950 6.930 N Sidt2 n/a
6 TRCN0000175565 CCAGTTTGATACCTCCTTCAT pLKO.1 2071 CDS 100% 4.950 3.465 N Sidt2 n/a
7 TRCN0000292685 CCAGTTTGATACCTCCTTCAT pLKO_005 2071 CDS 100% 4.950 3.465 N Sidt2 n/a
8 TRCN0000173875 GCACGAAAGGACAAACGTGTT pLKO.1 1646 CDS 100% 4.050 2.835 N Sidt2 n/a
9 TRCN0000292760 GCACGAAAGGACAAACGTGTT pLKO_005 1646 CDS 100% 4.050 2.835 N Sidt2 n/a
10 TRCN0000173769 CCTGGGCATATTCTTGTCCTT pLKO.1 1243 CDS 100% 2.640 1.848 N Sidt2 n/a
11 TRCN0000173828 CTTTGGTACTTGGTTGCCCTT pLKO.1 3999 3UTR 100% 2.160 1.512 N Sidt2 n/a
12 TRCN0000193502 GTACCAGATTTACTTCTGGAA pLKO.1 1678 CDS 100% 0.000 0.000 N Sidt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172257.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11947 pDONR223 100% 88.8% 94.3% None (many diffs) n/a
2 ccsbBroad304_11947 pLX_304 0% 88.8% 94.3% V5 (many diffs) n/a
3 TRCN0000467022 TGCTTCTGCTGGGTACGCTTGCTA pLX_317 10.2% 88.8% 94.3% V5 (many diffs) n/a
Download CSV