Transcript: Mouse NM_172300.3

Mus musculus ubiquitin-conjugating enzyme E2Z (Ube2z), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ube2z (268470)
Length:
3974
CDS:
91..1161

Additional Resources:

NCBI RefSeq record:
NM_172300.3
NBCI Gene record:
Ube2z (268470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305849 ACAGTGTCTACTTCGGATTAA pLKO_005 390 CDS 100% 13.200 18.480 N Ube2z n/a
2 TRCN0000320606 GCGGGATATCATGTCCATTTA pLKO_005 411 CDS 100% 13.200 18.480 N UBE2Z n/a
3 TRCN0000041217 CTCGGGTCAAACTGATGACAA pLKO.1 584 CDS 100% 4.950 6.930 N Ube2z n/a
4 TRCN0000022406 GCCAAACTATGCAGGACCCTT pLKO.1 977 CDS 100% 2.640 3.696 N UBE2Z n/a
5 TRCN0000041214 CGGGATATCATGTCCATTTAT pLKO.1 412 CDS 100% 15.000 12.000 N Ube2z n/a
6 TRCN0000324885 CGGGATATCATGTCCATTTAT pLKO_005 412 CDS 100% 15.000 12.000 N Ube2z n/a
7 TRCN0000305782 CTCTGCAGGGCCAGCTAATTA pLKO_005 1444 3UTR 100% 15.000 12.000 N Ube2z n/a
8 TRCN0000320607 ACTGATGACAACGGGCAATAA pLKO_005 594 CDS 100% 13.200 9.240 N UBE2Z n/a
9 TRCN0000041216 GCATCTTCAAGGCCAAACTAT pLKO.1 966 CDS 100% 5.625 3.938 N Ube2z n/a
10 TRCN0000041215 CCGACACTGTTGACATGACTA pLKO.1 464 CDS 100% 4.950 3.465 N Ube2z n/a
11 TRCN0000324884 CCGACACTGTTGACATGACTA pLKO_005 464 CDS 100% 4.950 3.465 N Ube2z n/a
12 TRCN0000041213 CCTGGAGTATTATGACTTCTA pLKO.1 921 CDS 100% 4.950 3.465 N Ube2z n/a
13 TRCN0000324798 CCTGGAGTATTATGACTTCTA pLKO_005 921 CDS 100% 4.950 3.465 N Ube2z n/a
14 TRCN0000022408 TCTGCTTGAGTATTCTAGGTA pLKO.1 656 CDS 100% 3.000 2.100 N UBE2Z n/a
15 TRCN0000022405 CAAACTGATGACAACGGGCAA pLKO.1 591 CDS 100% 2.160 1.512 N UBE2Z n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12517 pDONR223 100% 65.5% 69.1% None (many diffs) n/a
2 ccsbBroad304_12517 pLX_304 0% 65.5% 69.1% V5 (many diffs) n/a
3 TRCN0000478813 TAATAATCCCCTCTGATATATGAC pLX_317 51.3% 65.5% 69.1% V5 (many diffs) n/a
Download CSV