Transcript: Human NM_172311.3

Homo sapiens STON1-GTF2A1L readthrough (STON1-GTF2A1L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
STON1-GTF2A1L (286749)
Length:
4067
CDS:
357..3905

Additional Resources:

NCBI RefSeq record:
NM_172311.3
NBCI Gene record:
STON1-GTF2A1L (286749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018008 TGCTACAACATCCAGCCTAAA pLKO.1 2475 CDS 100% 10.800 7.560 N STON1-GTF2A1L n/a
2 TRCN0000421888 AGATACAGCTTGATCCATATT pLKO_005 1318 CDS 100% 13.200 6.600 Y STON1-GTF2A1L n/a
3 TRCN0000426677 CAGACAGCCCACTCGCAATAT pLKO_005 685 CDS 100% 13.200 6.600 Y STON1-GTF2A1L n/a
4 TRCN0000421051 CATCCAATTCAGCAAGTATTT pLKO_005 2925 CDS 100% 13.200 6.600 Y STON1-GTF2A1L n/a
5 TRCN0000427465 GACCTGTTTGACACGGATAAT pLKO_005 3753 CDS 100% 13.200 6.600 Y STON1-GTF2A1L n/a
6 TRCN0000017379 GCATCCAATTCAGCAAGTATT pLKO.1 2924 CDS 100% 13.200 6.600 Y GTF2A1L n/a
7 TRCN0000018011 GCGTTTCAAGACTTTGTATAA pLKO.1 1901 CDS 100% 13.200 6.600 Y STON1-GTF2A1L n/a
8 TRCN0000428394 TATTGTCTGTCAGTATGATAA pLKO_005 3776 CDS 100% 13.200 6.600 Y GTF2A1L n/a
9 TRCN0000418300 TGAAGGAGTTCGGAATCTATT pLKO_005 2525 CDS 100% 13.200 6.600 Y GTF2A1L n/a
10 TRCN0000422368 AGTAGATGGAAGCGGTGATAC pLKO_005 3512 CDS 100% 10.800 5.400 Y GTF2A1L n/a
11 TRCN0000188076 CCCTCTGATTGGTATCCATTT pLKO.1 2346 CDS 100% 10.800 5.400 Y STON1 n/a
12 TRCN0000203795 CGAAGCGAGATGAATCCTATT pLKO.1 1747 CDS 100% 10.800 5.400 Y STON1 n/a
13 TRCN0000421861 GTGCTACAGCAACCCGCAATT pLKO_005 3045 CDS 100% 10.800 5.400 Y GTF2A1L n/a
14 TRCN0000186696 GATGCGTTTCAAGACTTTGTA pLKO.1 1898 CDS 100% 5.625 2.813 Y STON1 n/a
15 TRCN0000017380 GCAATCGTCAACAGCATCATT pLKO.1 2702 CDS 100% 5.625 2.813 Y GTF2A1L n/a
16 TRCN0000194286 GCAGTGGTATGGAAGATAGAT pLKO.1 2244 CDS 100% 5.625 2.813 Y STON1 n/a
17 TRCN0000204320 CCGAAGCGAGATGAATCCTAT pLKO.1 1746 CDS 100% 4.950 2.475 Y STON1 n/a
18 TRCN0000018012 CCTAAATAAGTGTTCACTCAA pLKO.1 1016 CDS 100% 4.950 2.475 Y STON1-GTF2A1L n/a
19 TRCN0000018010 CGAAGCAAGAACAAATGGAAA pLKO.1 3804 CDS 100% 4.950 2.475 Y STON1-GTF2A1L n/a
20 TRCN0000017382 GAAGGTATAGAGGAACAAGTT pLKO.1 2553 CDS 100% 4.950 2.475 Y GTF2A1L n/a
21 TRCN0000017378 GCCAGTAGATAGGAAACACTT pLKO.1 3077 CDS 100% 4.950 2.475 Y GTF2A1L n/a
22 TRCN0000204738 GCTGAGAACCAAGACTCACTT pLKO.1 1071 CDS 100% 4.950 2.475 Y STON1 n/a
23 TRCN0000017381 CAGACCTGTTTGACACGGATA pLKO.1 3751 CDS 100% 4.050 2.025 Y GTF2A1L n/a
24 TRCN0000018009 CCTCCAAGTAACTCTCCTCTT pLKO.1 579 CDS 100% 4.050 2.025 Y STON1-GTF2A1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02603 pDONR223 100% 40.2% 40.1% None (many diffs) n/a
2 ccsbBroad304_02603 pLX_304 0% 40.2% 40.1% V5 (many diffs) n/a
3 TRCN0000481558 GCATATTCAGAGCCCGACATATGC pLX_317 5.6% 40.2% 40.1% V5 (many diffs) n/a
Download CSV