Transcript: Human NM_172389.3

Homo sapiens nuclear factor of activated T cells 1 (NFATC1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
NFATC1 (4772)
Length:
4325
CDS:
94..2532

Additional Resources:

NCBI RefSeq record:
NM_172389.3
NBCI Gene record:
NFATC1 (4772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172389.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017334 CCCGCCAACGTTCCAATTATA pLKO.1 2137 CDS 100% 15.000 21.000 N NFATC1 n/a
2 TRCN0000422015 ATTTGCTACTGTAGGAGTATT pLKO_005 2979 3UTR 100% 13.200 18.480 N NFATC1 n/a
3 TRCN0000424832 CCCGAAGACTACTCCTCTTTC pLKO_005 1156 CDS 100% 10.800 15.120 N NFATC1 n/a
4 TRCN0000017333 CGGCAACATTAGAAAGTGATT pLKO.1 3616 3UTR 100% 4.950 6.930 N NFATC1 n/a
5 TRCN0000017336 CATCGAGATAACCTCGTGCTT pLKO.1 411 CDS 100% 2.640 2.112 N NFATC1 n/a
6 TRCN0000017335 CGTCAGTTTCTACGTCTGCAA pLKO.1 2073 CDS 100% 2.640 2.112 N NFATC1 n/a
7 TRCN0000417132 ATACTGGAAGTGCCTTATTTA pLKO_005 2922 3UTR 100% 15.000 10.500 N NFATC1 n/a
8 TRCN0000017337 CGGAATCCTGAAACTCAGAAA pLKO.1 1656 CDS 100% 4.950 3.465 N NFATC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172389.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06634 pDONR223 100% 82.4% 79.8% None (many diffs) n/a
2 ccsbBroad304_06634 pLX_304 0% 82.4% 79.8% V5 (many diffs) n/a
3 TRCN0000471213 GCCGAAGGAGTGCTTTTTACAGCG pLX_317 17.1% 82.4% 79.8% V5 (many diffs) n/a
4 ccsbBroadEn_06635 pDONR223 100% 82.4% 79.8% None (many diffs) n/a
5 ccsbBroad304_06635 pLX_304 0% 82.4% 79.8% V5 (many diffs) n/a
6 TRCN0000477265 TACCGAAAATGACCATACATTGCC pLX_317 17.1% 82.4% 79.8% V5 (many diffs) n/a
Download CSV