Transcript: Mouse NM_172442.3

Mus musculus deltex 4, E3 ubiquitin ligase (Dtx4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dtx4 (207521)
Length:
5786
CDS:
780..2630

Additional Resources:

NCBI RefSeq record:
NM_172442.3
NBCI Gene record:
Dtx4 (207521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040777 CGCCGTCTCATCTTTGCCATT pLKO.1 2427 CDS 100% 4.050 5.670 N Dtx4 n/a
2 TRCN0000040774 GCCCAACATGTAAGACCATTT pLKO.1 2161 CDS 100% 10.800 8.640 N Dtx4 n/a
3 TRCN0000040775 CATTGGCTTCAGCTACATAAT pLKO.1 1163 CDS 100% 13.200 9.240 N Dtx4 n/a
4 TRCN0000236609 GGCTACCCAGATGCCAATTAC pLKO_005 2538 CDS 100% 13.200 9.240 N DTX4 n/a
5 TRCN0000040773 GCCACTTTGAATCGGTCCAAT pLKO.1 1638 CDS 100% 4.950 3.465 N Dtx4 n/a
6 TRCN0000040776 CCAGATGCCAATTACCTGGAT pLKO.1 2544 CDS 100% 2.640 1.848 N Dtx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11698 pDONR223 100% 72.1% 76.7% None (many diffs) n/a
2 ccsbBroad304_11698 pLX_304 0% 72.1% 76.7% V5 (many diffs) n/a
3 TRCN0000465429 GCTCTGGAGTCGTTACAGTTTAGG pLX_317 22.3% 72.1% 76.7% V5 (many diffs) n/a
Download CSV