Transcript: Mouse NM_172557.2

Mus musculus RUN and FYVE domain containing 1 (Rufy1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rufy1 (216724)
Length:
2657
CDS:
7..2145

Additional Resources:

NCBI RefSeq record:
NM_172557.2
NBCI Gene record:
Rufy1 (216724)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241683 GCCGAAACTGTGGCCACATTT pLKO_005 2009 CDS 100% 13.200 18.480 N Rufy1 n/a
2 TRCN0000241685 CTTCTGTGTCCTCAGTTAAAT pLKO_005 2380 3UTR 100% 15.000 10.500 N Rufy1 n/a
3 TRCN0000241681 AGCTGCAACAGACCGAATTTG pLKO_005 1050 CDS 100% 13.200 9.240 N Rufy1 n/a
4 TRCN0000241682 CTATGAGCCCGAGGCCTTAAT pLKO_005 729 CDS 100% 13.200 9.240 N Rufy1 n/a
5 TRCN0000192740 GCAGAGAGCATGAAAGAATTA pLKO.1 902 CDS 100% 13.200 9.240 N Rufy1 n/a
6 TRCN0000217654 GAACGAAGTAATTCGAGAAAG pLKO.1 1107 CDS 100% 10.800 7.560 N Rufy1 n/a
7 TRCN0000202352 GCAGCAGTTGCACTAGAGAAT pLKO.1 2475 3UTR 100% 4.950 3.465 N Rufy1 n/a
8 TRCN0000201331 GAAAGAATTACCGATGTCCTT pLKO.1 913 CDS 100% 2.640 1.848 N Rufy1 n/a
9 TRCN0000241684 GGTTGAACTGGAGACTTATAA pLKO_005 1167 CDS 100% 15.000 9.000 N Rufy1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09020 pDONR223 100% 74.3% 79.9% None (many diffs) n/a
2 ccsbBroad304_09020 pLX_304 0% 74.3% 79.9% V5 (many diffs) n/a
3 TRCN0000469015 GGAGGAGGTCTCCTAAGCCCCTAG pLX_317 18.1% 74.3% 79.9% V5 (many diffs) n/a
Download CSV