Construct: ORF TRCN0000469015
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013173.1_s317c1
- Derived from:
- ccsbBroadEn_09020
- DNA Barcode:
- GGAGGAGGTCTCCTAAGCCCCTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RUFY1 (80230)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469015
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | NM_001040451.3 | 99.9% | 100% | 1218G>A |
| 2 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | NM_001040452.3 | 99.9% | 100% | 1218G>A |
| 3 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_017009891.1 | 96.2% | 96.1% | 566_567ins66;1152G>A |
| 4 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | NM_025158.5 | 84.6% | 84.7% | 1_324del;1542G>A |
| 5 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_006714921.3 | 81.5% | 81.4% | 1_324del;890_891ins66;1476G>A |
| 6 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_005265993.4 | 77.4% | 77.5% | 0_1ins405;813G>A |
| 7 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XR_245277.3 | 77% | (many diffs) | |
| 8 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_024446220.1 | 72.5% | 71.9% | (many diffs) |
| 9 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_017009893.2 | 68.9% | 68.1% | (many diffs) |
| 10 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XR_001742278.1 | 64.6% | (many diffs) | |
| 11 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XR_245276.3 | 63.7% | (many diffs) | |
| 12 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XR_001742279.1 | 62.2% | (many diffs) | |
| 13 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_006714922.3 | 61.2% | 61.1% | (many diffs) |
| 14 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_017009894.1 | 61.2% | 61.1% | (many diffs) |
| 15 | human | 80230 | RUFY1 | RUN and FYVE domain contain... | XM_017009895.2 | 51.6% | 51.6% | 0_1ins870;348G>A |
| 16 | mouse | 216724 | Rufy1 | RUN and FYVE domain contain... | XM_006532841.3 | 85.5% | 91.9% | (many diffs) |
| 17 | mouse | 216724 | Rufy1 | RUN and FYVE domain contain... | NM_172557.2 | 74.3% | 79.9% | (many diffs) |
| 18 | mouse | 216724 | Rufy1 | RUN and FYVE domain contain... | XR_001779949.1 | 47.9% | (many diffs) | |
| 19 | mouse | 216724 | Rufy1 | RUN and FYVE domain contain... | XM_017314442.1 | 32.6% | 32.8% | (many diffs) |
| 20 | mouse | 216724 | Rufy1 | RUN and FYVE domain contain... | XR_001779948.1 | 30.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1866
- ORF length:
- 1800
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ggaggagcgt gccaacctga tgcacatgat gaaactcagc atcaaggtgt 121 tgctccagtc ggctctgagc ctgggccgca gcctggatgc ggaccatgcc cccttgcagc 181 agttctttgt agtgatggag cactgcctca aacatgggct gaaagttaag aagagtttta 241 ttggccaaaa taaatcattc tttggtcctt tggagctggt ggagaaactt tgtccagaag 301 catcagatat agcgactagt gtcagaaatc ttccagaatt aaagacagct gtgggaagag 361 gccgagcgtg gctttatctt gcactcatgc aaaagaaact ggcagattat ctgaaagtgc 421 ttatagacaa taaacatctc ttaagcgagt tctatgagcc tgaggcttta atgatggagg 481 aagaagggat ggtgattgtt ggtctgctgg tgggactcaa tgttctcgat gccaatctct 541 gcttgaaagg agaagacttg gattctcagg ttggagtaat agatttttcc ctctacctta 601 aggatgtgca ggatcttgat ggtggcaagg agcatgaaag aattactgat gtccttgatc 661 aaaaaaatta tgtggaagaa cttaaccggc acttgagctg cacagttggg gatcttcaaa 721 ccaagataga tggcttggaa aagactaact caaagcttca agaagagctt tcagctgcaa 781 cagaccgaat ttgctcactt caagaagaac agcagcagtt aagagaacaa aatgaattaa 841 ttcgagaaag aagtgaaaag agtgtagaga taacaaaaca ggataccaaa gttgagctgg 901 agacttacaa gcaaactcgg caaggtctgg atgaaatgta cagtgatgtg tggaagcagc 961 taaaagagga gaagaaagtc cggttggaac tggaaaaaga actggagtta caaattggaa 1021 tgaaaaccga aatggaaatt gcaatgaagt tactggaaaa ggacacccac gagaagcagg 1081 acacactagt tgccctccgc cagcagctgg aagaagtcaa agcgattaat ttacagatgt 1141 ttcacaaagc tcagaatgca gagagcagtt tgcagcagaa gaatgaagcc atcacatcct 1201 ttgaaggaaa aaccaaccaa gttatgtcca gcatgaaaca aatggaagaa aggttgcagc 1261 actcggagcg ggcgaggcag ggagctgagg agcggagcca caagctgcag caggagctgg 1321 gcgggaggat cggcgccctg cagctgcagc tctcccagct gcacgagcaa tgctcaagcc 1381 tggagaaaga attgaaatca gaaaaagagc aaagacaggc tcttcagcgc gaattacagc 1441 acgagaaaga cacttcctct ctactcagga tggagctgca acaagtggaa ggactgaaaa 1501 aggagttgcg ggagcttcag gacgagaagg cagagctgca gaagaTCTGC GAGGAGCAGG 1561 AACAAGCCCT CCAGGAAATG GGCCTGCACC TCAGCCAGTC CAAGCTGAAG ATGGAAGATA 1621 TAAAAGAAGT GAACCAGGCA CTGAAGGGCC ACGCCTGGCT GAAAGATGAC GAAGCGACAC 1681 ACTGTAGGCA GTGTGAGAAG GAGTTCTCCA TTTCCCGGAG AAAGCACCAC TGCCGGAACT 1741 GTGGCCACAT CTTCTGCAAC ACCTGCTCCA GCAACGAGCT GGCCCTGCCC TCCTACCCCA 1801 AGCCGGTGCG AGTGTGCGAC AGCTGCCACA CCCTGCTCCT GCAGCGCTGC TCCTCCACGG 1861 CCTCCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1921 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1981 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGGAGGAGGT CTCCTAAGCC CCTAGACGCG 2041 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt