Transcript: Mouse NM_172698.2

Mus musculus EF-hand calcium binding domain 14 (Efcab14), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Efcab14 (230648)
Length:
4320
CDS:
587..2176

Additional Resources:

NCBI RefSeq record:
NM_172698.2
NBCI Gene record:
Efcab14 (230648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266898 TCCATCAGAGCTTGACAATAA pLKO_005 1315 CDS 100% 13.200 18.480 N Efcab14 n/a
2 TRCN0000283363 GTCAGCCGCAGACTTACTTAG pLKO_005 1111 CDS 100% 10.800 15.120 N Efcab14 n/a
3 TRCN0000266896 GCTCTTAAGAATGGGTCTAAT pLKO_005 3769 3UTR 100% 13.200 10.560 N Efcab14 n/a
4 TRCN0000215791 CAAAGATCTTCAGGATTTATT pLKO.1 1861 CDS 100% 15.000 10.500 N Efcab14 n/a
5 TRCN0000266897 TCAAAGATCTTCAGGATTTAT pLKO_005 1860 CDS 100% 15.000 10.500 N Efcab14 n/a
6 TRCN0000053324 CCAGAGAGCTTGAGAGCATTT pLKO.1 1961 CDS 100% 10.800 7.560 N EFCAB14 n/a
7 TRCN0000300527 CCAGAGAGCTTGAGAGCATTT pLKO_005 1961 CDS 100% 10.800 7.560 N EFCAB14 n/a
8 TRCN0000215869 CTGGAACTAAGATTAGCTTTA pLKO.1 2012 CDS 100% 10.800 7.560 N Efcab14 n/a
9 TRCN0000266899 CTGGAACTAAGATTAGCTTTA pLKO_005 2012 CDS 100% 10.800 7.560 N Efcab14 n/a
10 TRCN0000195840 CCTCCATCAGAGCTTGACAAT pLKO.1 1313 CDS 100% 4.950 3.465 N Efcab14 n/a
11 TRCN0000195841 CCATCGGAGAAAGAAGACCAA pLKO.1 634 CDS 100% 2.640 1.848 N Efcab14 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2784 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02249 pDONR223 100% 76.9% 72.7% None (many diffs) n/a
2 ccsbBroad304_02249 pLX_304 0% 76.9% 72.7% V5 (many diffs) n/a
3 TRCN0000472444 TTGAATAAATCGCCACCAGGCTAT pLX_317 32.8% 76.9% 72.7% V5 (many diffs) n/a
Download CSV