Transcript: Mouse NM_172704.3

Mus musculus DnaJ heat shock protein family (Hsp40) member C11 (Dnajc11), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dnajc11 (230935)
Length:
2944
CDS:
34..1713

Additional Resources:

NCBI RefSeq record:
NM_172704.3
NBCI Gene record:
Dnajc11 (230935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439594 GAATCGACACAGACGGGTAAA pLKO_005 1694 CDS 100% 10.800 15.120 N Dnajc11 n/a
2 TRCN0000437979 GGTCTCAAGCTGTTCCGTAAT pLKO_005 703 CDS 100% 10.800 15.120 N Dnajc11 n/a
3 TRCN0000422121 GGGCACTGTATCAATTATGTG pLKO_005 1830 3UTR 100% 4.950 6.930 N Dnajc11 n/a
4 TRCN0000115449 CCCGCAGATTGAGATTAATAA pLKO.1 495 CDS 100% 15.000 10.500 N Dnajc11 n/a
5 TRCN0000236064 CTGGACAATGAAGACTATTAC pLKO_005 61 CDS 100% 13.200 9.240 N DNAJC11 n/a
6 TRCN0000115447 GCTGGACAATGAAGACTATTA pLKO.1 60 CDS 100% 13.200 9.240 N Dnajc11 n/a
7 TRCN0000425292 TCCTTTGCACTCATCAGTTAT pLKO_005 943 CDS 100% 13.200 9.240 N Dnajc11 n/a
8 TRCN0000115448 CGTTATGATGAGGAATATGAA pLKO.1 454 CDS 100% 5.625 3.938 N Dnajc11 n/a
9 TRCN0000115450 CAAGATGCTTTGTGACGACAA pLKO.1 731 CDS 100% 4.050 2.835 N Dnajc11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08574 pDONR223 100% 88.9% 96.4% None (many diffs) n/a
2 ccsbBroad304_08574 pLX_304 0% 88.9% 96.4% V5 (many diffs) n/a
3 TRCN0000465874 CCACTATTCTCGCAAAACGTTTTC pLX_317 21.8% 88.9% 96.4% V5 (many diffs) n/a
4 ccsbBroadEn_12263 pDONR223 100% 80.9% 88% None (many diffs) n/a
5 ccsbBroad304_12263 pLX_304 0% 80.9% 88% V5 (many diffs) n/a
6 TRCN0000469711 AGCCTTCGTAGATGATTCGTGCTT pLX_317 30.3% 80.9% 88% V5 (many diffs) n/a
Download CSV