Transcript: Mouse NM_172712.2

Mus musculus ubiquitin-like modifier activating enzyme 6 (Uba6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Uba6 (231380)
Length:
5101
CDS:
6..3167

Additional Resources:

NCBI RefSeq record:
NM_172712.2
NBCI Gene record:
Uba6 (231380)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112462 GCCATTCCAATAATAGTGTTT pLKO.1 2790 CDS 100% 4.950 6.930 N Uba6 n/a
2 TRCN0000421365 AGATACTCCAGCACTACTTTA pLKO_005 3179 3UTR 100% 13.200 9.240 N Uba6 n/a
3 TRCN0000112461 GCCCTCCAATTAAGTTCATTA pLKO.1 538 CDS 100% 13.200 9.240 N Uba6 n/a
4 TRCN0000422355 GGGATTAAGGCCCTAACAATT pLKO_005 255 CDS 100% 13.200 9.240 N Uba6 n/a
5 TRCN0000112460 CGCATTCTAAACAAGTGCTTA pLKO.1 4282 3UTR 100% 4.950 3.465 N Uba6 n/a
6 TRCN0000112464 CCCAGTGTGTAGAGTTAGCAA pLKO.1 2095 CDS 100% 3.000 2.100 N Uba6 n/a
7 TRCN0000112463 CCAGGTATTGTCACTTGCCTT pLKO.1 681 CDS 100% 2.640 1.848 N Uba6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12188 pDONR223 100% 31.7% 29.4% None (many diffs) n/a
2 ccsbBroad304_12188 pLX_304 0% 31.7% 29.4% V5 (many diffs) n/a
3 TRCN0000472225 CACTTCCGCTATCCATCCCTAAAG pLX_317 42.1% 31.7% 29.4% V5 (many diffs) n/a
Download CSV