Transcript: Mouse NM_172804.2

Mus musculus synaptotagmin XVI (Syt16), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Syt16 (238266)
Length:
2705
CDS:
91..1740

Additional Resources:

NCBI RefSeq record:
NM_172804.2
NBCI Gene record:
Syt16 (238266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381316 ATGCCACAACAGGGCGATTAT pLKO_005 1349 CDS 100% 13.200 18.480 N Syt16 n/a
2 TRCN0000093521 AGGGCGATTATCTGTGGAAAT pLKO.1 1359 CDS 100% 10.800 15.120 N Syt16 n/a
3 TRCN0000379542 AGATTTCAAAGGAGCTATAAA pLKO_005 2046 3UTR 100% 15.000 10.500 N Syt16 n/a
4 TRCN0000381417 GCAAGGGCAGGTCAATGATTT pLKO_005 525 CDS 100% 13.200 9.240 N Syt16 n/a
5 TRCN0000381047 GGTCTGCTTGTGAAGGTATTC pLKO_005 482 CDS 100% 10.800 7.560 N Syt16 n/a
6 TRCN0000093523 GCGCACTATGAAGCGTAAAGA pLKO.1 1596 CDS 100% 5.625 3.938 N Syt16 n/a
7 TRCN0000093520 CCTGTCTATAAAGAGACCTTT pLKO.1 1513 CDS 100% 4.950 3.465 N Syt16 n/a
8 TRCN0000093522 CGTCACCTTGATGATTTCCAT pLKO.1 1566 CDS 100% 3.000 2.100 N Syt16 n/a
9 TRCN0000093519 GCACCCAAAGAAGAAGAGGAA pLKO.1 2457 3UTR 100% 2.640 1.848 N Syt16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12755 pDONR223 100% 33.3% 34.4% None (many diffs) n/a
2 ccsbBroad304_12755 pLX_304 0% 33.3% 34.4% V5 (many diffs) n/a
3 TRCN0000479179 GACCTTACCGCCTCTGTGCTATGT pLX_317 77.2% 33.3% 34.4% V5 (many diffs) n/a
Download CSV