Transcript: Mouse NM_172812.2

Mus musculus 5-hydroxytryptamine (serotonin) receptor 2A (Htr2a), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Htr2a (15558)
Length:
2971
CDS:
1094..2509

Additional Resources:

NCBI RefSeq record:
NM_172812.2
NBCI Gene record:
Htr2a (15558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026299 CCAGGGTGTGTGAACAAGTTT pLKO.1 2534 3UTR 100% 5.625 3.938 N Htr2a n/a
2 TRCN0000026237 CCATTCTTCATCTCCAGGAAA pLKO.1 1293 CDS 100% 4.950 3.465 N Htr2a n/a
3 TRCN0000026297 CCCACTGGTATATACGTTGTT pLKO.1 2221 CDS 100% 4.950 3.465 N Htr2a n/a
4 TRCN0000026241 CGTAGGTATATCCATGCCAAT pLKO.1 1702 CDS 100% 4.050 2.835 N Htr2a n/a
5 TRCN0000026268 CGATGACAACTTTGTCCTCAT pLKO.1 1783 CDS 100% 4.050 2.430 N Htr2a n/a
6 TRCN0000009094 CCCTGCTCAATGTGTTTGTTT pLKO.1 2172 CDS 100% 5.625 3.375 N HTR2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488000 GTTGGTCTACTGTAAAAATCCTTC pLX_317 24.4% 87.5% 91.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488624 AAAATCAGCTTATGCATAATTCGT pLX_317 24.2% 87.4% 91.3% V5 (many diffs) n/a
Download CSV