Transcript: Mouse NM_172923.3

Mus musculus transmembrane protein 266 (Tmem266), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem266 (244886)
Length:
2407
CDS:
149..1765

Additional Resources:

NCBI RefSeq record:
NM_172923.3
NBCI Gene record:
Tmem266 (244886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127292 CTGTGTAATATTGGTGGTGAT pLKO.1 466 CDS 100% 4.050 5.670 N Tmem266 n/a
2 TRCN0000127289 CCAAGCCGTCTTTCCAGAAAT pLKO.1 2195 3UTR 100% 13.200 9.240 N Tmem266 n/a
3 TRCN0000263930 CCAACAAGTAGACGAAGAAAC pLKO_005 229 CDS 100% 10.800 7.560 N TMEM266 n/a
4 TRCN0000127290 CCCAACAAGTAGACGAAGAAA pLKO.1 228 CDS 100% 5.625 3.938 N Tmem266 n/a
5 TRCN0000127293 CAGCAGTATGTGTGGTCACTA pLKO.1 1188 CDS 100% 4.950 3.465 N Tmem266 n/a
6 TRCN0000127291 GCCTCATCATCATGTTCCGAA pLKO.1 753 CDS 100% 2.640 1.848 N Tmem266 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13099 pDONR223 100% 55.3% 55.3% None (many diffs) n/a
2 ccsbBroad304_13099 pLX_304 0% 55.3% 55.3% V5 (many diffs) n/a
3 TRCN0000476039 CAAACCTATGCTATCACAATCCCT pLX_317 28.1% 55.3% 55.3% V5 (many diffs) n/a
Download CSV