Transcript: Mouse NM_173014.1

Mus musculus lysophosphatidylcholine acyltransferase 2 (Lpcat2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Lpcat2 (270084)
Length:
2800
CDS:
106..1740

Additional Resources:

NCBI RefSeq record:
NM_173014.1
NBCI Gene record:
Lpcat2 (270084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247203 TCCCTCTGTTGCTAGTAATAA pLKO_005 1668 CDS 100% 15.000 21.000 N Lpcat2 n/a
2 TRCN0000190631 GCCCTAAAGCACCCAGAATAT pLKO.1 1573 CDS 100% 13.200 18.480 N Lpcat2 n/a
3 TRCN0000247202 TTTCGCACTCTCCATAGTATA pLKO_005 2277 3UTR 100% 13.200 18.480 N Lpcat2 n/a
4 TRCN0000247200 CCACGTTCTTCGACGGAATTG pLKO_005 545 CDS 100% 10.800 15.120 N Lpcat2 n/a
5 TRCN0000247201 ATCGAGGAGTTTGCGGAATAC pLKO_005 1246 CDS 100% 10.800 8.640 N Lpcat2 n/a
6 TRCN0000191233 CCCTCTGTTGCTAGTAATAAA pLKO.1 1669 CDS 100% 15.000 10.500 N Lpcat2 n/a
7 TRCN0000247199 GATCATCCAGGTGGCATTTAA pLKO_005 1398 CDS 100% 15.000 10.500 N Lpcat2 n/a
8 TRCN0000191351 CCCAATAAGCAAATCAGATTT pLKO.1 2447 3UTR 100% 13.200 9.240 N Lpcat2 n/a
9 TRCN0000217395 GAATTGGAATCGAGGAGTTTG pLKO.1 1238 CDS 100% 10.800 7.560 N Lpcat2 n/a
10 TRCN0000055779 CCTCCTCAGATACCCAAACAA pLKO.1 843 CDS 100% 5.625 3.938 N LPCAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03492 pDONR223 100% 84.6% 88.4% None (many diffs) n/a
2 ccsbBroad304_03492 pLX_304 0% 84.6% 88.4% V5 (many diffs) n/a
3 TRCN0000466414 ACACGCGACTGCCCACTGGCATTA pLX_317 10.4% 84.6% 88.4% V5 (many diffs) n/a
Download CSV