Transcript: Human NM_173519.3

Homo sapiens clavesin 1 (CLVS1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CLVS1 (157807)
Length:
3472
CDS:
321..1385

Additional Resources:

NCBI RefSeq record:
NM_173519.3
NBCI Gene record:
CLVS1 (157807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421317 GGCAGATGATCCCGGCATTAA pLKO_005 656 CDS 100% 13.200 18.480 N CLVS1 n/a
2 TRCN0000432142 GATCCGGAGCTTCAGATAAAT pLKO_005 834 CDS 100% 15.000 12.000 N CLVS1 n/a
3 TRCN0000146720 CAGCTAATACACCCTGAATTT pLKO.1 1098 CDS 100% 13.200 9.240 N CLVS1 n/a
4 TRCN0000147115 CTGACACCTTCAATCCTTAAA pLKO.1 909 CDS 100% 13.200 9.240 N CLVS1 n/a
5 TRCN0000150060 CTTAAAGACAAGACCAGGAAA pLKO.1 1038 CDS 100% 4.950 3.465 N CLVS1 n/a
6 TRCN0000147651 GACTATACTCACACATCCTAT pLKO.1 1209 CDS 100% 4.950 3.465 N CLVS1 n/a
7 TRCN0000146576 CCCTATTGGTAGAGAACAATA pLKO.1 2826 3UTR 100% 1.320 0.924 N CLVS1 n/a
8 TRCN0000149098 GCATCGAATTGTTCAGCCTAA pLKO.1 1905 3UTR 100% 4.050 2.430 N CLVS1 n/a
9 TRCN0000105402 CGTACAGATGATGCCTTCATT pLKO.1 528 CDS 100% 5.625 3.938 N Clvs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14413 pDONR223 100% 99.9% 99.1% None 1055delC n/a
2 ccsbBroad304_14413 pLX_304 0% 99.9% 99.1% V5 (not translated due to frame shift) 1055delC n/a
3 TRCN0000470813 CTTCCTCTACTCAGTTTCCTACCG pLX_317 41.9% 99.9% 99.1% V5 (not translated due to frame shift) 1055delC n/a
Download CSV