Construct: ORF TRCN0000470813
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009612.1_s317c1
- Derived from:
- ccsbBroadEn_14413
- DNA Barcode:
- CTTCCTCTACTCAGTTTCCTACCG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CLVS1 (157807)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470813
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 157807 | CLVS1 | clavesin 1 | NM_173519.3 | 99.9% | 99.1% | 1055delC |
| 2 | human | 157807 | CLVS1 | clavesin 1 | XM_017013141.2 | 99.9% | 99.1% | 1055delC |
| 3 | human | 157807 | CLVS1 | clavesin 1 | XM_017013142.2 | 99.9% | 99.1% | 1055delC |
| 4 | human | 157807 | CLVS1 | clavesin 1 | XM_024447079.1 | 99.9% | 99.1% | 1055delC |
| 5 | mouse | 74438 | Clvs1 | clavesin 1 | NM_028940.2 | 89.4% | 96.3% | (many diffs) |
| 6 | mouse | 74438 | Clvs1 | clavesin 1 | XM_011250125.2 | 89.4% | 96.3% | (many diffs) |
| 7 | mouse | 74438 | Clvs1 | clavesin 1 | XM_006538321.3 | 64% | 51.6% | (many diffs) |
| 8 | mouse | 74438 | Clvs1 | clavesin 1 | XM_006538322.3 | 51.5% | 55.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1128
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg accagtctct cttcttccaa aatatcagaa gttaaacact tggaacggag 121 atttggccaa gatgacccat ttacaggctg gactcagtcc agagactata gagaaagctc 181 gcctggaact gaatgaaaac cccgatgttt tacatcagga tattcagcaa gtcagggaca 241 tgatcatcac caggcctgac attggatttt tacgtacaga tgatgccttc atcctgagat 301 ttctccgagc caggaagttt caccaagcgg atgcctttag actcctggct cagtatttcc 361 agtaccgcca gctaaacctg gacatgttca aaaacttcaa ggcagatgat cccggcatta 421 agagggctct gatcgatggg ttccccgggg tgctggaaaa ccgagaccat tacggcagga 481 agattctttt gctgtttgca gccaattggg atcagagtag gaactccttc acagacatcc 541 ttcgtgccat cctgctgtca ttggaagtcc taatcgaaga tccggagctt cagataaatg 601 gcttcatttt aattatagac tggagtaatt tttccttcaa acaagcctcc aaactgacac 661 cttcaatcct taaactggcc attGAAGGGT TGCAGGACAG CTTTCCTGCC CGCTTTGGAG 721 GAGTCCACTT TGTCAACCAG CCCTGGTACA TTCATGCCCT CTACACACTC ATCAAGCCAT 781 TTCTTAAAGA CAAGACCAGG AAACGGATTT TCCTGCATGG AAACAATTTA AACAGCCTTC 841 ACCAGCTAAT ACACCCTGAA TTTTTGCCCT CTGAATTTGG AGGAACTCTT CCTCCTTATG 901 ACATGGGAAC TTGGGCCCGG ACGTTACTCG GTCCCGACTA CAGCGATGAA AATGACTATA 961 CTCACACATC CTATAATGCA ATGCACGTGA AGCATACGTC CTCGAATCTG GAGAGAGAAT 1021 GCTCACCCAA GCTGATGAAA AGATCTCAGT CTGTGGTAGA AGCTGGGACC CTGAAACATG 1081 AGGAGAAGGG AGAGAATGAG AACACCCAGC CACTCCTGGT CTGGACTGCC CAACTTTCTT 1141 GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC 1201 GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG 1261 TGGAAAGGAC GACTTCCTCT ACTCAGTTTC CTACCGACGC GTTAAGTCga caatcaacct 1321 ctggattaca aaatttgtga aagatt