Transcript: Human NM_173666.4

Homo sapiens DTW domain containing 2 (DTWD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
DTWD2 (285605)
Length:
5776
CDS:
37..933

Additional Resources:

NCBI RefSeq record:
NM_173666.4
NBCI Gene record:
DTWD2 (285605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173666.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244597 ATTCGGATGCAGCCGACTAAT pLKO_005 670 CDS 100% 13.200 10.560 N DTWD2 n/a
2 TRCN0000244598 CTTAGTCATGACCAGTAATAT pLKO_005 3838 3UTR 100% 15.000 10.500 N DTWD2 n/a
3 TRCN0000244595 TCTACCCACTTGTACATAATT pLKO_005 310 CDS 100% 15.000 10.500 N DTWD2 n/a
4 TRCN0000244599 TTCGCCCTCTTCAAGCTTTAT pLKO_005 770 CDS 100% 13.200 9.240 N DTWD2 n/a
5 TRCN0000244596 TGCCGGAAGTCTGGTACATTA pLKO_005 463 CDS 100% 13.200 7.920 N DTWD2 n/a
6 TRCN0000167749 GCATTTCTAGTCAGTATGTAA pLKO.1 650 CDS 100% 5.625 2.813 Y DTWD2 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2208 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2208 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2206 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2206 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2206 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173666.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05403 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05403 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469764 CCTAGGCTACGAGTTAGAATACTG pLX_317 46.4% 100% 100% V5 n/a
Download CSV