Transcript: Human NM_174914.4

Homo sapiens UDP glycosyltransferase family 3 member A2 (UGT3A2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
UGT3A2 (167127)
Length:
2342
CDS:
94..1665

Additional Resources:

NCBI RefSeq record:
NM_174914.4
NBCI Gene record:
UGT3A2 (167127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152680 GAGAACTTCGACATGGTGATA pLKO.1 502 CDS 100% 4.950 6.930 N UGT3A2 n/a
2 TRCN0000442854 GGACCACTGACCCTCAGATTT pLKO_005 1948 3UTR 100% 13.200 9.240 N UGT3A2 n/a
3 TRCN0000426590 GCCATTCTTTCCACTTCATTC pLKO_005 583 CDS 100% 10.800 7.560 N UGT3A2 n/a
4 TRCN0000152351 CCTTCTAGTTATCTCCTGTTT pLKO.1 1758 3UTR 100% 4.950 3.465 N UGT3A2 n/a
5 TRCN0000151772 CAATATCTACAGTAGGTGGAA pLKO.1 173 CDS 100% 2.640 1.848 N UGT3A2 n/a
6 TRCN0000152776 GAATAGCATAATGGAGGCCAT pLKO.1 1209 CDS 100% 2.160 1.512 N UGT3A2 n/a
7 TRCN0000152264 CTCTGACTTTGCCTTTGATTT pLKO.1 843 CDS 100% 13.200 7.920 N UGT3A2 n/a
8 TRCN0000150098 CCTTGTCTTATGTTCCAGTAT pLKO.1 632 CDS 100% 4.950 2.475 Y UGT3A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05141 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05141 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475349 CCCCTCTAGATCCTGCCCAAAGGG pLX_317 28.1% 100% 100% V5 n/a
4 ccsbBroadEn_04885 pDONR223 100% 85.8% 78.8% None (many diffs) n/a
5 ccsbBroad304_04885 pLX_304 0% 85.8% 78.8% V5 (many diffs) n/a
6 TRCN0000471431 GCAGTGCGTTCTTTAACGATTGAA pLX_317 28.1% 85.8% 78.8% V5 (many diffs) n/a
Download CSV