Transcript: Human NM_174975.4

Homo sapiens SEC14 like lipid binding 3 (SEC14L3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SEC14L3 (266629)
Length:
2089
CDS:
90..1292

Additional Resources:

NCBI RefSeq record:
NM_174975.4
NBCI Gene record:
SEC14L3 (266629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174975.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060056 GAGACCATCGTGATGATATTT pLKO.1 528 CDS 100% 15.000 12.000 N SEC14L3 n/a
2 TRCN0000060055 GTGGAATACGAGATCCTATTT pLKO.1 963 CDS 100% 13.200 10.560 N SEC14L3 n/a
3 TRCN0000060057 GTTCCGGAAGACCATGGATAT pLKO.1 272 CDS 100% 10.800 7.560 N SEC14L3 n/a
4 TRCN0000060054 CGTGAAAGCTACCAAACTGTT pLKO.1 662 CDS 100% 4.950 3.465 N SEC14L3 n/a
5 TRCN0000060053 CCCAAATGTTTAACCAAGATT pLKO.1 843 CDS 100% 5.625 3.375 N SEC14L3 n/a
6 TRCN0000101991 GTGATGATATTTGACTGTGAA pLKO.1 537 CDS 100% 4.950 3.465 N Sec14l3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174975.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09928 pDONR223 100% 99.8% 99.7% None 930T>C;1005T>G n/a
2 ccsbBroad304_09928 pLX_304 0% 99.8% 99.7% V5 930T>C;1005T>G n/a
3 TRCN0000478468 CTCCCCTGACGTATCCTGGTCACG pLX_317 10.7% 99.8% 99.7% V5 930T>C;1005T>G n/a
4 ccsbBroadEn_09929 pDONR223 100% 99.6% 99.2% None (many diffs) n/a
5 ccsbBroad304_09929 pLX_304 0% 99.6% 99.2% V5 (many diffs) n/a
6 TRCN0000477387 CTGTGATATGGCTGCATGTCTCTC pLX_317 34.1% 99.6% 99.2% V5 (many diffs) n/a
Download CSV