Transcript: Human NM_175068.3

Homo sapiens keratin 73 (KRT73), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KRT73 (319101)
Length:
2284
CDS:
36..1658

Additional Resources:

NCBI RefSeq record:
NM_175068.3
NBCI Gene record:
KRT73 (319101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175068.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437659 ACGCAGCTTACACGAGCAAAG pLKO_005 766 CDS 100% 6.000 8.400 N KRT73 n/a
2 TRCN0000108252 GCCCGGAGCATCTCTTTCAAT pLKO.1 195 CDS 100% 5.625 7.875 N KRT73 n/a
3 TRCN0000108251 CGTGAGCATTTCGGTCATCAA pLKO.1 1391 CDS 100% 4.950 6.930 N KRT73 n/a
4 TRCN0000108253 CGGAGAATATACCAACTCCGT pLKO.1 1373 CDS 100% 0.066 0.092 N KRT73 n/a
5 TRCN0000428787 TTGTATAGCCACTGCATATTA pLKO_005 2133 3UTR 100% 15.000 10.500 N KRT73 n/a
6 TRCN0000429782 GGGAAAGACCTTAGCTCTAAG pLKO_005 1610 CDS 100% 10.800 7.560 N KRT73 n/a
7 TRCN0000108250 GCCTCAGTCTTTGTTAATGTT pLKO.1 1807 3UTR 100% 5.625 3.938 N KRT73 n/a
8 TRCN0000108254 GCTTCAGCAGTCGGAGCCTTT pLKO.1 160 CDS 100% 1.350 0.945 N KRT73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175068.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09379 pDONR223 100% 81.8% 81.3% None (many diffs) n/a
2 ccsbBroad304_09379 pLX_304 0% 81.8% 81.3% V5 (many diffs) n/a
3 TRCN0000471794 CGTGTGGTGATATAGAGAAACATC pLX_317 26.4% 81.8% 81.3% V5 (many diffs) n/a
4 ccsbBroadEn_13575 pDONR223 100% 69.5% 68.3% None (many diffs) n/a
5 ccsbBroad304_13575 pLX_304 0% 69.5% 68.3% V5 (many diffs) n/a
6 TRCN0000478787 CAGGTATTATTAGAGCATTGGAGC pLX_317 28% 69.5% 68.3% V5 (many diffs) n/a
Download CSV