Transcript: Mouse NM_175402.4

Mus musculus RNA binding motif protein 15B (Rbm15b), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Rbm15b (109095)
Length:
3016
CDS:
34..2697

Additional Resources:

NCBI RefSeq record:
NM_175402.4
NBCI Gene record:
Rbm15b (109095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138935 GAATGGGCTTCTGGTGTTGAA pLKO.1 2190 CDS 100% 4.950 3.960 N RBM15B n/a
2 TRCN0000125603 GAACACATGGTGATAGTTATA pLKO.1 2659 CDS 100% 13.200 9.240 N Rbm15b n/a
3 TRCN0000125601 CACATGGTGATAGTTATAGTA pLKO.1 2662 CDS 100% 5.625 3.938 N Rbm15b n/a
4 TRCN0000125600 GCCTTCCTCAAGTTTCAGAAT pLKO.1 1159 CDS 100% 4.950 3.465 N Rbm15b n/a
5 TRCN0000125602 CTTTCCGACATCTATGCACAT pLKO.1 2220 CDS 100% 4.050 2.835 N Rbm15b n/a
6 TRCN0000125599 CCTTCTCCCTTGGTTTGAATT pLKO.1 2772 3UTR 100% 0.000 0.000 N Rbm15b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11910 pDONR223 100% 55.9% 60.9% None (many diffs) n/a
2 ccsbBroad304_11910 pLX_304 0% 55.9% 60.9% V5 (many diffs) n/a
3 TRCN0000481366 CACGTGGAATAGTAGCTCACGGGT pLX_317 27% 55.9% 60.9% V5 (many diffs) n/a
4 ccsbBroadEn_15808 pDONR223 0% 41.4% 44.7% None (many diffs) n/a
5 ccsbBroad304_15808 pLX_304 0% 41.4% 44.7% V5 (many diffs) n/a
6 TRCN0000491732 TGCCCGGGACTGTGCATATCAGAG pLX_317 29.2% 41.4% 44.7% V5 (many diffs) n/a
Download CSV