Transcript: Mouse NM_175523.4

Mus musculus protein phosphatase 1K (PP2C domain containing) (Ppm1k), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ppm1k (243382)
Length:
5560
CDS:
226..1344

Additional Resources:

NCBI RefSeq record:
NM_175523.4
NBCI Gene record:
Ppm1k (243382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175523.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081376 GTGGGTTTGTAGCTTGGAATA pLKO.1 947 CDS 100% 10.800 15.120 N Ppm1k n/a
2 TRCN0000081375 CTCTGAAATTACCTTCTCATT pLKO.1 1287 CDS 100% 4.950 3.960 N Ppm1k n/a
3 TRCN0000081373 GCCTGATTCTACCTGAAAGAA pLKO.1 4361 3UTR 100% 5.625 3.938 N Ppm1k n/a
4 TRCN0000081377 ACTTGCAATGACAAGGAGTAT pLKO.1 996 CDS 100% 4.950 3.465 N Ppm1k n/a
5 TRCN0000081374 CCTAGCATCAAGTACGGCAAA pLKO.1 460 CDS 100% 4.050 2.835 N Ppm1k n/a
6 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 3338 3UTR 100% 2.640 1.320 Y P3h3 n/a
7 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 3338 3UTR 100% 2.640 1.320 Y P3h3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175523.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09692 pDONR223 100% 87.6% 90% None (many diffs) n/a
2 ccsbBroad304_09692 pLX_304 0% 87.6% 90% V5 (many diffs) n/a
3 TRCN0000474353 TCCCATACCAACACTCTCAAGCCC pLX_317 48% 87.6% 90% V5 (many diffs) n/a
4 TRCN0000488473 GAGGATGCTTGGGGATCGGTTCAA pLX_317 28.3% 87.6% 90% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV