Transcript: Mouse NM_175524.4

Mus musculus RIKEN cDNA C130060K24 gene (C130060K24Rik), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
C130060K24Rik (243407)
Length:
2953
CDS:
1..1251

Additional Resources:

NCBI RefSeq record:
NM_175524.4
NBCI Gene record:
C130060K24Rik (243407)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175524.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027772 CGTTTGCTATTGCATTGTGAA pLKO.1 1035 CDS 100% 4.950 6.930 N C130060K24Rik n/a
2 TRCN0000027804 GCTCCGAACTATTCATGGAAA pLKO.1 753 CDS 100% 4.950 6.930 N C130060K24Rik n/a
3 TRCN0000027791 CGTTCACATGATGATTGAATA pLKO.1 870 CDS 100% 13.200 10.560 N C130060K24Rik n/a
4 TRCN0000027805 GCAGCGACTTGAGATTAAGTA pLKO.1 546 CDS 100% 5.625 4.500 N C130060K24Rik n/a
5 TRCN0000027837 GCACTGCCATTGTGACAGAAA pLKO.1 374 CDS 100% 4.950 2.970 N C130060K24Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175524.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489301 CAGTTGCCCTAATCGCATATATCG pLX_317 24% 81.4% 78.6% V5 (many diffs) n/a
2 TRCN0000488019 GACCGTGCGAGCACTCACGAGTTA pLX_317 23.9% 81.4% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488188 TCGGCTTGAATGCGCTTCAACACT pLX_317 13.2% 81% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12778 pDONR223 100% 67.9% 66% None (many diffs) n/a
5 ccsbBroad304_12778 pLX_304 0% 67.9% 66% V5 (many diffs) n/a
6 TRCN0000475571 ACCAGAATCATGAAACTGATACCC pLX_317 28.7% 67.9% 66% V5 (many diffs) n/a
Download CSV