Transcript: Human NM_175722.3

Homo sapiens thyroid peroxidase (TPO), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TPO (7173)
Length:
2543
CDS:
2..2284

Additional Resources:

NCBI RefSeq record:
NM_175722.3
NBCI Gene record:
TPO (7173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437890 GACACGCACTGGCACTAAATC pLKO_005 2101 CDS 100% 13.200 18.480 N TPO n/a
2 TRCN0000045970 GCTGAGCATCATTGCAAACAT pLKO.1 370 CDS 100% 5.625 4.500 N TPO n/a
3 TRCN0000446547 AGCTGACGGAAAGGCTCTTTG pLKO_005 1158 CDS 100% 10.800 7.560 N TPO n/a
4 TRCN0000429677 ATCATCACCCTGAGGGATTAC pLKO_005 821 CDS 100% 10.800 7.560 N TPO n/a
5 TRCN0000045968 CGAGAGGGAAAGAACTCCTTT pLKO.1 72 CDS 100% 4.950 3.465 N TPO n/a
6 TRCN0000444747 GGTCCCTATGAAGGCTATGAC pLKO_005 884 CDS 100% 4.950 3.465 N TPO n/a
7 TRCN0000418409 CAAACACAGGCAAATCCGAAA pLKO_005 2349 3UTR 100% 4.050 2.835 N TPO n/a
8 TRCN0000045971 GTCACAGATGATGACCGCTAT pLKO.1 659 CDS 100% 4.050 2.835 N TPO n/a
9 TRCN0000045972 CCCTACGAGTTAGGAGACGAT pLKO.1 1964 CDS 100% 2.640 1.848 N TPO n/a
10 TRCN0000045969 CGACAAGATCCTGGACTTGTA pLKO.1 1339 CDS 100% 0.495 0.347 N TPO n/a
11 TRCN0000432869 GAAATCAGCAGGACGACTGTT pLKO_005 2366 3UTR 100% 4.950 2.970 N TPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488822 TCGTACTTAATCTAGTTCGGGTTA pLX_317 10.6% 81.3% 81.3% V5 (not translated due to prior stop codon) 12C>G;208C>G;819_820ins519 n/a
2 ccsbBroadEn_11199 pDONR223 100% 21.5% 21.5% None (many diffs) n/a
3 ccsbBroad304_11199 pLX_304 0% 21.5% 21.5% V5 (many diffs) n/a
4 TRCN0000468704 CTGAATGCACCTTAAGTAGGCCTT pLX_317 79.7% 21.5% 21.5% V5 (many diffs) n/a
Download CSV