Transcript: Mouse NM_175750.3

Mus musculus plexin A4 (Plxna4), mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Mus musculus (mouse)
Gene:
Plxna4 (243743)
Length:
12602
CDS:
975..6656

Additional Resources:

NCBI RefSeq record:
NM_175750.3
NBCI Gene record:
Plxna4 (243743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175750.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424968 CAGATCAATGATCGCATTAAG pLKO_005 2055 CDS 100% 13.200 18.480 N Plxna4 n/a
2 TRCN0000432578 GATCTATCTGACACGACTATT pLKO_005 5996 CDS 100% 13.200 18.480 N Plxna4 n/a
3 TRCN0000415827 AGACCAACTTCACCTATTATC pLKO_005 4369 CDS 100% 13.200 9.240 N Plxna4 n/a
4 TRCN0000422453 GGCGCTCTCCATCCTACATTA pLKO_005 3964 CDS 100% 13.200 9.240 N Plxna4 n/a
5 TRCN0000078759 CCCTCGTATCACAGAGATCAT pLKO.1 3542 CDS 100% 4.950 3.465 N Plxna4 n/a
6 TRCN0000078760 CGGATTGTTCAGACCTGCAAT pLKO.1 1266 CDS 100% 4.950 3.465 N Plxna4 n/a
7 TRCN0000078762 GCAGGTGTCAACTGTACCTTT pLKO.1 2736 CDS 100% 4.950 3.465 N Plxna4 n/a
8 TRCN0000078761 GCTCCTTACTATTGATGACAA pLKO.1 2159 CDS 100% 4.950 3.465 N Plxna4 n/a
9 TRCN0000078758 CCTTTCATTTCTCTGCCTCTT pLKO.1 6784 3UTR 100% 4.050 2.430 N Plxna4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175750.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09318 pDONR223 100% 23.6% 23.8% None (many diffs) n/a
2 ccsbBroad304_09318 pLX_304 0% 23.6% 23.8% V5 (many diffs) n/a
3 TRCN0000471262 TTAATACTGAATGATTGGCCACGG pLX_317 25.5% 23.6% 23.8% V5 (many diffs) n/a
4 ccsbBroadEn_15213 pDONR223 0% 23.6% 23.8% None (many diffs) n/a
5 ccsbBroad304_15213 pLX_304 0% 23.6% 23.8% V5 (many diffs) n/a
6 TRCN0000479825 ATTTGACATTCATAACGAACGTTT pLX_317 22.5% 23.6% 23.8% V5 (many diffs) n/a
Download CSV