Transcript: Human NM_175907.6

Homo sapiens zinc binding alcohol dehydrogenase domain containing 2 (ZADH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZADH2 (284273)
Length:
7518
CDS:
82..1215

Additional Resources:

NCBI RefSeq record:
NM_175907.6
NBCI Gene record:
ZADH2 (284273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175907.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230012 GATCGTCCTATCAACTATAAA pLKO_005 736 CDS 100% 15.000 21.000 N ZADH2 n/a
2 TRCN0000116006 CCGTGCTGTCAATTATATGTA pLKO.1 1131 CDS 100% 5.625 7.875 N ZADH2 n/a
3 TRCN0000230013 ATTCCGTGCTGTCAATTATAT pLKO_005 1128 CDS 100% 15.000 10.500 N ZADH2 n/a
4 TRCN0000230014 GTGAAGCCCACCAGATTATTT pLKO_005 2487 3UTR 100% 15.000 10.500 N ZADH2 n/a
5 TRCN0000218338 CTGTCAACAGTAAGCTGTAAA pLKO_005 1196 CDS 100% 13.200 9.240 N ZADH2 n/a
6 TRCN0000116002 GCACTTTATGTCTCAGAATTA pLKO.1 1256 3UTR 100% 13.200 9.240 N ZADH2 n/a
7 TRCN0000116005 CCTGAACCATTACCTTTCTAA pLKO.1 993 CDS 100% 5.625 3.938 N ZADH2 n/a
8 TRCN0000116003 CGCTTGATAGTAATAGGGTTT pLKO.1 874 CDS 100% 4.050 2.835 N ZADH2 n/a
9 TRCN0000116004 CGGAACCGATTTGTTGGTGTT pLKO.1 283 CDS 100% 4.050 2.835 N ZADH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175907.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09957 pDONR223 100% 99.9% 99.7% None 1117G>A n/a
2 ccsbBroad304_09957 pLX_304 0% 99.9% 99.7% V5 1117G>A n/a
3 ccsbBroadEn_09958 pDONR223 100% 99.9% 100% None 225C>T n/a
4 ccsbBroad304_09958 pLX_304 0% 99.9% 100% V5 225C>T n/a
5 TRCN0000468811 AATAAAAGCTATTTCATATTATAG pLX_317 31.5% 99.9% 100% V5 225C>T n/a
Download CSV