Transcript: Mouse NM_176933.4

Mus musculus dual specificity phosphatase 4 (Dusp4), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Dusp4 (319520)
Length:
2427
CDS:
120..1316

Additional Resources:

NCBI RefSeq record:
NM_176933.4
NBCI Gene record:
Dusp4 (319520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054348 CGAGTACATCGACGCAGTAAA pLKO.1 920 CDS 100% 13.200 18.480 N Dusp4 n/a
2 TRCN0000054352 ACGGACATCTGCCTGCTTAAA pLKO.1 543 CDS 100% 13.200 9.240 N Dusp4 n/a
3 TRCN0000054350 CAATCACTTTGAGGGTCATTA pLKO.1 830 CDS 100% 13.200 9.240 N Dusp4 n/a
4 TRCN0000054351 GCTGATGAACCGGGATGAGAA pLKO.1 170 CDS 100% 4.950 3.465 N Dusp4 n/a
5 TRCN0000054349 GTCTCTTCAGACTGTCCCAAT pLKO.1 813 CDS 100% 4.050 2.835 N Dusp4 n/a
6 TRCN0000368367 CGCAGTTCGTCTTCAGCTTTC pLKO_005 1216 CDS 100% 6.000 8.400 N DUSP4 n/a
7 TRCN0000011051 TCGCAGTTCGTCTTCAGCTTT pLKO.1 1215 CDS 100% 4.950 3.960 N DUSP4 n/a
8 TRCN0000006842 GCCTACCTGATGATGAAGAAA pLKO.1 1008 CDS 100% 5.625 3.375 N DUSP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06130 pDONR223 100% 89% 95.9% None (many diffs) n/a
2 ccsbBroad304_06130 pLX_304 0% 89% 95.9% V5 (many diffs) n/a
3 TRCN0000470819 CGATCACTGAATGGTGGTAGCCGT pLX_317 42% 89% 95.9% V5 (many diffs) n/a
4 TRCN0000489427 GCTCTTCGTACTCTTATGGTACAG pLX_317 31.4% 89% 95.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV