Transcript: Mouse NM_177224.2

Mus musculus chromodomain helicase DNA binding protein 9 (Chd9), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Chd9 (109151)
Length:
11517
CDS:
372..8981

Additional Resources:

NCBI RefSeq record:
NM_177224.2
NBCI Gene record:
Chd9 (109151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127328 CCTGGAGTTATGCTTGATATA pLKO.1 2487 CDS 100% 13.200 10.560 N Chd9 n/a
2 TRCN0000127324 CCTGTGAGATAGCCAAAGTTT pLKO.1 10780 3UTR 100% 5.625 4.500 N Chd9 n/a
3 TRCN0000380957 AGCCTCCTTGACACCTATAAT pLKO_005 9340 3UTR 100% 15.000 10.500 N CHD9 n/a
4 TRCN0000127327 GCAGTTAAAGTCTACAGATTA pLKO.1 4266 CDS 100% 13.200 9.240 N Chd9 n/a
5 TRCN0000127326 GCGTCCTTCTATACCACCAAA pLKO.1 7245 CDS 100% 4.950 3.465 N Chd9 n/a
6 TRCN0000127325 CGGTCATACAAATCAGGCTTT pLKO.1 1250 CDS 100% 4.050 2.835 N Chd9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12681 pDONR223 100% 3.6% .8% None (many diffs) n/a
2 ccsbBroad304_12681 pLX_304 0% 3.6% .8% V5 (many diffs) n/a
3 TRCN0000472257 TAGCGCCTGCTAATAAACTTCACC pLX_317 100% 3.6% .8% V5 (many diffs) n/a
Download CSV