Transcript: Mouse NM_177233.5

Mus musculus family with sequence similarity 19, member A4 (Fam19a4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fam19a4 (320701)
Length:
2182
CDS:
423..830

Additional Resources:

NCBI RefSeq record:
NM_177233.5
NBCI Gene record:
Fam19a4 (320701)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177233.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264643 ATACGTGTGTTCTAGATTAAA pLKO_005 1284 3UTR 100% 15.000 21.000 N Fam19a4 n/a
2 TRCN0000264640 TCCTGTAGCAGTGGCAATAAA pLKO_005 783 CDS 100% 15.000 21.000 N Fam19a4 n/a
3 TRCN0000215525 GTTCTGACCTATGTGTTAATG pLKO.1 465 CDS 100% 13.200 9.240 N Fam19a4 n/a
4 TRCN0000264639 GTTCTGACCTATGTGTTAATG pLKO_005 465 CDS 100% 13.200 9.240 N Fam19a4 n/a
5 TRCN0000264641 TTGGAAGGAGAGGACTGTAAA pLKO_005 738 CDS 100% 13.200 9.240 N Fam19a4 n/a
6 TRCN0000264642 TTGAAGCTGCCATTGTGATTG pLKO_005 688 CDS 100% 10.800 7.560 N Fam19a4 n/a
7 TRCN0000184490 GCACAGCCTTCTTGTGTTGAA pLKO.1 672 CDS 100% 4.950 3.465 N Fam19a4 n/a
8 TRCN0000179288 GCTCAGAAGTTCATAGCCAAA pLKO.1 927 3UTR 100% 4.050 2.835 N Fam19a4 n/a
9 TRCN0000184404 CTGCTGCAATAAGAACCGCAT pLKO.1 587 CDS 100% 2.160 1.512 N Fam19a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177233.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05055 pDONR223 100% 85.2% 90% None (many diffs) n/a
2 ccsbBroad304_05055 pLX_304 0% 85.2% 90% V5 (many diffs) n/a
3 TRCN0000480668 GGTCCCTAGTCCCCTATCTTCAAG pLX_317 100% 85.2% 90% V5 (many diffs) n/a
Download CSV