Transcript: Mouse NM_177242.4

Mus musculus PTC7 protein phosphatase homolog (Pptc7), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pptc7 (320717)
Length:
4611
CDS:
272..1204

Additional Resources:

NCBI RefSeq record:
NM_177242.4
NBCI Gene record:
Pptc7 (320717)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080893 CCGACATTTAATTCCTGCTAA pLKO.1 3103 3UTR 100% 4.950 6.930 N Pptc7 n/a
2 TRCN0000318134 CCGACATTTAATTCCTGCTAA pLKO_005 3103 3UTR 100% 4.950 6.930 N Pptc7 n/a
3 TRCN0000080897 GCACTACTTCAACACTCCATT pLKO.1 820 CDS 100% 4.950 6.930 N Pptc7 n/a
4 TRCN0000318062 GCACTACTTCAACACTCCATT pLKO_005 820 CDS 100% 4.950 6.930 N Pptc7 n/a
5 TRCN0000080894 CGCTGCTGATAGCACATCTTT pLKO.1 898 CDS 100% 5.625 4.500 N Pptc7 n/a
6 TRCN0000318132 CGCTGCTGATAGCACATCTTT pLKO_005 898 CDS 100% 5.625 4.500 N Pptc7 n/a
7 TRCN0000080895 GCTGGCCTATGACCCAAATTA pLKO.1 1075 CDS 100% 15.000 10.500 N Pptc7 n/a
8 TRCN0000318133 GCTGGCCTATGACCCAAATTA pLKO_005 1075 CDS 100% 15.000 10.500 N Pptc7 n/a
9 TRCN0000379830 GAGCTGGCCTATGACCCAAAT pLKO_005 1073 CDS 100% 10.800 7.560 N PPTC7 n/a
10 TRCN0000002705 CCACATTTCTTTGCCACTGAT pLKO.1 1283 3UTR 100% 4.950 3.465 N PPTC7 n/a
11 TRCN0000315121 CCACATTTCTTTGCCACTGAT pLKO_005 1283 3UTR 100% 4.950 3.465 N PPTC7 n/a
12 TRCN0000080896 CCCAAATTATATGTCACCTTT pLKO.1 1087 CDS 100% 4.950 3.465 N Pptc7 n/a
13 TRCN0000002701 ACCCAAATTATATGTCACCTT pLKO.1 1086 CDS 100% 2.640 1.848 N PPTC7 n/a
14 TRCN0000315056 TTGACAACATGCCTGATTATA pLKO_005 966 CDS 100% 15.000 21.000 N PPTC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05108 pDONR223 100% 87.6% 97% None (many diffs) n/a
2 ccsbBroad304_05108 pLX_304 0% 87.6% 97% V5 (many diffs) n/a
3 TRCN0000475008 CGCAAACGCTTCGTTCCAGATGTG pLX_317 51.7% 87.6% 97% V5 (many diffs) n/a
Download CSV