Transcript: Mouse NM_177249.3

Mus musculus ubiquitin specific peptidase 47 (Usp47), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Usp47 (74996)
Length:
5600
CDS:
203..4333

Additional Resources:

NCBI RefSeq record:
NM_177249.3
NBCI Gene record:
Usp47 (74996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233568 GATGATGGTGCCGTCATATTT pLKO_005 4133 CDS 100% 15.000 21.000 N Usp47 n/a
2 TRCN0000233569 AGGATGTATTTGCTCGTTAAT pLKO_005 5176 3UTR 100% 13.200 18.480 N Usp47 n/a
3 TRCN0000233565 GTGAGTGAACGGATCACATTA pLKO_005 368 CDS 100% 13.200 18.480 N Usp47 n/a
4 TRCN0000030870 CCGTGTTATGTTTGATGCTTT pLKO.1 1033 CDS 100% 4.950 6.930 N Usp47 n/a
5 TRCN0000030872 GCAAATACAATCCGGTTATTT pLKO.1 2657 CDS 100% 1.500 2.100 N Usp47 n/a
6 TRCN0000030871 GCTGGATATGAGCACATTTAT pLKO.1 1444 CDS 100% 15.000 10.500 N Usp47 n/a
7 TRCN0000327307 GCTGGATATGAGCACATTTAT pLKO_005 1444 CDS 100% 15.000 10.500 N Usp47 n/a
8 TRCN0000030873 CCAACAAAGTAGGCTACATAA pLKO.1 435 CDS 100% 13.200 9.240 N Usp47 n/a
9 TRCN0000233567 TGGTTATGTGGGATTAGTAAA pLKO_005 757 CDS 100% 13.200 9.240 N Usp47 n/a
10 TRCN0000233566 TGTGGCCTCTACCAATGATTA pLKO_005 688 CDS 100% 13.200 9.240 N Usp47 n/a
11 TRCN0000030869 GCCACTGTCTTGACTTGGAAT pLKO.1 4487 3UTR 100% 4.950 3.465 N Usp47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12140 pDONR223 100% 10.2% 10.6% None (many diffs) n/a
2 ccsbBroad304_12140 pLX_304 0% 10.2% 10.6% V5 (many diffs) n/a
3 TRCN0000492128 GTGCGATGTCCGATACTACTGTAG pLX_317 85.5% 10.2% 10.6% V5 (many diffs) n/a
Download CSV