Transcript: Mouse NM_177290.3

Mus musculus integrin beta 8 (Itgb8), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Itgb8 (320910)
Length:
3096
CDS:
479..2782

Additional Resources:

NCBI RefSeq record:
NM_177290.3
NBCI Gene record:
Itgb8 (320910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177290.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067304 GCTGCAAATCTCAACAATTTA pLKO.1 1586 CDS 100% 15.000 21.000 N Itgb8 n/a
2 TRCN0000412408 TCAGCATCAATGCACAATAAT pLKO_005 944 CDS 100% 15.000 10.500 N ITGB8 n/a
3 TRCN0000067307 CGGGTTGCTTAAAGTTCTTAT pLKO.1 2560 CDS 100% 13.200 9.240 N Itgb8 n/a
4 TRCN0000067305 GCCCAAGCTATCTGCGAATAT pLKO.1 2508 CDS 100% 13.200 9.240 N Itgb8 n/a
5 TRCN0000067306 GCCAAAGTGAACACAATAGAT pLKO.1 597 CDS 100% 5.625 3.938 N Itgb8 n/a
6 TRCN0000067303 GCAAGTGTCTTCACAACCATA pLKO.1 2905 3UTR 100% 4.950 3.465 N Itgb8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177290.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10927 pDONR223 100% 50% 49.8% None (many diffs) n/a
2 ccsbBroad304_10927 pLX_304 0% 50% 49.8% V5 (many diffs) n/a
3 TRCN0000492260 CACAAAAAGGGCTAGGCCAAGATA pLX_317 35.4% 50% 49.8% V5 (many diffs) n/a
Download CSV