Transcript: Mouse NM_177325.3

Mus musculus TSR1 20S rRNA accumulation (Tsr1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tsr1 (104662)
Length:
3395
CDS:
40..2451

Additional Resources:

NCBI RefSeq record:
NM_177325.3
NBCI Gene record:
Tsr1 (104662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249804 GTCTGTGCGTGACGATCTATA pLKO_005 1392 CDS 100% 13.200 18.480 N Tsr1 n/a
2 TRCN0000249805 TAGAGATTATGCTCGGATATT pLKO_005 1599 CDS 100% 13.200 18.480 N Tsr1 n/a
3 TRCN0000249806 TATCGTTGGACACGGTGATTT pLKO_005 909 CDS 100% 13.200 18.480 N Tsr1 n/a
4 TRCN0000179212 GCCCGAAAGAAGCTAAGTAAA pLKO.1 646 CDS 100% 13.200 10.560 N Tsr1 n/a
5 TRCN0000257962 GCCCGAAAGAAGCTAAGTAAA pLKO_005 646 CDS 100% 13.200 10.560 N Tsr1 n/a
6 TRCN0000249803 GGAGTCTAGTAGGTTACATTC pLKO_005 2937 3UTR 100% 10.800 8.640 N Tsr1 n/a
7 TRCN0000217919 GTCTCAGTGGTTGAGTATTTC pLKO.1 1735 CDS 100% 13.200 9.240 N Tsr1 n/a
8 TRCN0000196152 GCTGAGTGGATTCTGGATGAA pLKO.1 1243 CDS 100% 4.950 3.465 N Tsr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08570 pDONR223 100% 84.4% 85.7% None (many diffs) n/a
2 ccsbBroad304_08570 pLX_304 0% 84.4% 85.7% V5 (many diffs) n/a
3 TRCN0000478716 AGCCCGAAATTGCTGTACTGAGGA pLX_317 16% 84.4% 85.7% V5 (many diffs) n/a
4 ccsbBroadEn_12260 pDONR223 100% 69.4% 71.1% None (many diffs) n/a
5 ccsbBroad304_12260 pLX_304 0% 69.4% 71.1% V5 (many diffs) n/a
6 TRCN0000476405 AATAAGCTCTGGACGAGTCGGCTG pLX_317 18.8% 69.4% 71.1% V5 (many diffs) n/a
Download CSV