Transcript: Mouse NM_177460.4

Mus musculus poly (ADP-ribose) polymerase family, member 16 (Parp16), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Parp16 (214424)
Length:
2483
CDS:
285..1253

Additional Resources:

NCBI RefSeq record:
NM_177460.4
NBCI Gene record:
Parp16 (214424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336408 GTACTTTGTAGTCACCAATAA pLKO_005 1043 CDS 100% 13.200 18.480 N Parp16 n/a
2 TRCN0000336342 CAAGAGGGACTGTCGTGTTTC pLKO_005 1704 3UTR 100% 10.800 8.640 N Parp16 n/a
3 TRCN0000190801 GCCTCTTTCTGGTGTTGTTAT pLKO.1 2072 3UTR 100% 13.200 9.240 N Parp16 n/a
4 TRCN0000336407 TGAAGTACCTGCTGGTGTATT pLKO_005 1078 CDS 100% 13.200 9.240 N Parp16 n/a
5 TRCN0000336409 GAGAACGAGACCTAATCTATG pLKO_005 712 CDS 100% 10.800 7.560 N Parp16 n/a
6 TRCN0000200923 CAAGTGCCAAATCAAGAAGAA pLKO.1 953 CDS 100% 4.950 3.465 N Parp16 n/a
7 TRCN0000053170 CCAAAGGAGAACGAGACCTAA pLKO.1 706 CDS 100% 4.950 3.465 N PARP16 n/a
8 TRCN0000201597 CCTGAACAAGACTTCTCTGTT pLKO.1 794 CDS 100% 4.950 3.465 N Parp16 n/a
9 TRCN0000190330 CGGAACCAAATGTTTGCGTTT pLKO.1 1956 3UTR 100% 4.050 2.835 N Parp16 n/a
10 TRCN0000336341 ACTTGAGCCTGGCCCTCATTT pLKO_005 841 CDS 100% 13.200 7.920 N Parp16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12121 pDONR223 100% 86.9% 90% None (many diffs) n/a
2 ccsbBroad304_12121 pLX_304 0% 86.9% 90% V5 (many diffs) n/a
3 TRCN0000467473 TGCCGCCCGGAACTAGAAACGCGG pLX_317 27.1% 86.9% 90% V5 (many diffs) n/a
4 ccsbBroadEn_03496 pDONR223 100% 86.9% 90% None (many diffs) n/a
5 ccsbBroad304_03496 pLX_304 0% 86.9% 90% V5 (many diffs) n/a
6 TRCN0000471995 GTGACGTGGTTTACTCTACAAATT pLX_317 35.6% 86.9% 90% V5 (many diffs) n/a
Download CSV