Transcript: Mouse NM_177547.3

Mus musculus serum/glucocorticoid regulated kinase 3 (Sgk3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sgk3 (170755)
Length:
5410
CDS:
240..1730

Additional Resources:

NCBI RefSeq record:
NM_177547.3
NBCI Gene record:
Sgk3 (170755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177547.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022747 GCAAAGAAGGAATCGCTATTT pLKO.1 1162 CDS 100% 13.200 18.480 N Sgk3 n/a
2 TRCN0000292537 GCAAAGAAGGAATCGCTATTT pLKO_005 1162 CDS 100% 13.200 18.480 N Sgk3 n/a
3 TRCN0000194738 CCAAGAGAATATTTGGTGATA pLKO.1 460 CDS 100% 4.950 6.930 N SGK3 n/a
4 TRCN0000022745 CGCAGAGTTTGACAAACTTTA pLKO.1 392 CDS 100% 13.200 10.560 N Sgk3 n/a
5 TRCN0000298002 CGCAGAGTTTGACAAACTTTA pLKO_005 392 CDS 100% 13.200 10.560 N Sgk3 n/a
6 TRCN0000001521 GCCGAGATGTTGCTGAAATGT pLKO.1 1327 CDS 100% 5.625 4.500 N SGK3 n/a
7 TRCN0000199867 GCTGCCCAAGTGTAAGCATTC pLKO.1 274 CDS 100% 6.000 4.200 N SGK3 n/a
8 TRCN0000022746 GCTGTCAAAGTGTTACAGAAA pLKO.1 804 CDS 100% 4.950 3.465 N Sgk3 n/a
9 TRCN0000297999 GCTGTCAAAGTGTTACAGAAA pLKO_005 804 CDS 100% 4.950 3.465 N Sgk3 n/a
10 TRCN0000022748 GCCAAGAGAATATTTGGTGAT pLKO.1 459 CDS 100% 4.050 2.835 N Sgk3 n/a
11 TRCN0000022744 GCCAAAGAAGACTTTCTTGAA pLKO.1 1455 CDS 100% 0.495 0.347 N Sgk3 n/a
12 TRCN0000292536 GCCAAAGAAGACTTTCTTGAA pLKO_005 1455 CDS 100% 0.495 0.347 N Sgk3 n/a
13 TRCN0000191370 CACAGCATTCTAAAGGAAGTA pLKO.1 4947 3UTR 100% 4.950 2.475 Y Mrps36 n/a
14 TRCN0000191675 GAAATGGAATTTATCCAGCGT pLKO.1 5067 3UTR 100% 0.660 0.330 Y Mrps36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177547.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02831 pDONR223 100% 90.3% 96.7% None (many diffs) n/a
2 ccsbBroad304_02831 pLX_304 13.3% 90.3% 96.7% V5 (many diffs) n/a
3 TRCN0000468685 TTGAAGTCAGGACCAGACGTTATT pLX_317 23.8% 90.3% 96.7% V5 (many diffs) n/a
4 ccsbBroadEn_15022 pDONR223 0% 90.3% 96.7% None (many diffs) n/a
5 ccsbBroad304_15022 pLX_304 13.3% 90.3% 96.7% V5 (many diffs) n/a
6 TRCN0000469217 ACGGTTCGTGCAACGCCATGTATG pLX_317 22.2% 90.3% 96.7% V5 (many diffs) n/a
7 TRCN0000488506 CGATGACTGCGAGTCCATCGGAGT pLX_317 17% 90.3% 96.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV