Transcript: Mouse NM_177909.5

Mus musculus solute carrier family 9 (sodium/hydrogen exchanger), member 9 (Slc9a9), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc9a9 (331004)
Length:
3492
CDS:
171..2105

Additional Resources:

NCBI RefSeq record:
NM_177909.5
NBCI Gene record:
Slc9a9 (331004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177909.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068853 GCCTCATAATGGGACTAATTT pLKO.1 346 CDS 100% 15.000 21.000 N Slc9a9 n/a
2 TRCN0000068854 CCTCACATACTCTATATCCAT pLKO.1 917 CDS 100% 3.000 4.200 N Slc9a9 n/a
3 TRCN0000068855 CGACTGATATTGATAGTGGAA pLKO.1 385 CDS 100% 2.640 2.112 N Slc9a9 n/a
4 TRCN0000068856 CTGGGCAGAAAGCAGAAGATT pLKO.1 1431 CDS 100% 5.625 3.938 N Slc9a9 n/a
5 TRCN0000068857 GAGAATATCTACGAGGGAGAT pLKO.1 2022 CDS 100% 4.050 2.835 N Slc9a9 n/a
6 TRCN0000413015 TTGCCAGAGCCTGCAACATAT pLKO_005 1387 CDS 100% 13.200 7.920 N SLC9A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177909.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05391 pDONR223 100% 86.2% 92.4% None (many diffs) n/a
2 ccsbBroad304_05391 pLX_304 0% 86.2% 92.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000480407 TCAACCCCATAATAGGGTCCACGA pLX_317 17.7% 86.2% 92.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV