Transcript: Human NM_177999.3

Homo sapiens ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ASB6 (140459)
Length:
4494
CDS:
153..746

Additional Resources:

NCBI RefSeq record:
NM_177999.3
NBCI Gene record:
ASB6 (140459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177999.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150611 GATCCACAATACTGAGAACAT pLKO.1 601 CDS 100% 4.950 3.960 N ASB6 n/a
2 TRCN0000154281 GCAGATCCACAATACTGAGAA pLKO.1 598 CDS 100% 4.950 3.960 N ASB6 n/a
3 TRCN0000150925 GCCTTAACAAGGTCCTTATAT pLKO.1 2201 3UTR 100% 15.000 10.500 N ASB6 n/a
4 TRCN0000155783 CACAGTGTTCACCTGCATCAT pLKO.1 676 CDS 100% 4.950 3.465 N ASB6 n/a
5 TRCN0000155125 CATGGTGACCAACTCTCAGAA pLKO.1 1039 3UTR 100% 4.950 3.465 N ASB6 n/a
6 TRCN0000151345 GAAGAGCTTTAAACTGCACTT pLKO.1 844 3UTR 100% 4.050 2.835 N ASB6 n/a
7 TRCN0000155020 GACCAACTCTCAGAAACTCCA pLKO.1 1045 3UTR 100% 2.640 1.848 N ASB6 n/a
8 TRCN0000154583 GATGATCAACCGCTTCTGCTT pLKO.1 742 CDS 100% 2.640 1.848 N ASB6 n/a
9 TRCN0000155377 CTTTGAAGACCCAGTCACCTA pLKO.1 440 CDS 100% 2.640 1.584 N ASB6 n/a
10 TRCN0000140759 GCCTTTCAAAGTGCTGGGATT pLKO.1 2638 3UTR 100% 4.050 2.025 Y INAVA n/a
11 TRCN0000155070 GCCTTTCAAAGTGCTGGGATT pLKO.1 2638 3UTR 100% 4.050 2.025 Y ASB6 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2954 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2954 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177999.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09585 pDONR223 100% 99.8% 100% None 207G>C n/a
2 ccsbBroad304_09585 pLX_304 0% 99.8% 100% V5 207G>C n/a
3 TRCN0000491643 ACAAGGCCCATCTGCCTTGGAATA pLX_317 55.6% 99.8% 100% V5 207G>C n/a
4 ccsbBroadEn_09586 pDONR223 100% 46.7% 32.3% None 207G>C;401_402ins109;591_592ins563 n/a
5 ccsbBroad304_09586 pLX_304 0% 46.7% 32.3% V5 207G>C;401_402ins109;591_592ins563 n/a
6 TRCN0000478926 CAGCCATCTTTGTGTGCCTTTTTT pLX_317 30.3% 46.7% 32.3% V5 207G>C;401_402ins109;591_592ins563 n/a
Download CSV