Transcript: Human NM_178169.4

Homo sapiens Ras association domain family member 3 (RASSF3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RASSF3 (283349)
Length:
3507
CDS:
139..855

Additional Resources:

NCBI RefSeq record:
NM_178169.4
NBCI Gene record:
RASSF3 (283349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178169.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077898 CGCCTTTCTATCTGTAGATTT pLKO.1 964 3UTR 100% 13.200 18.480 N RASSF3 n/a
2 TRCN0000423451 CATCCACTCTACCTGCGTTTG pLKO_005 625 CDS 100% 6.000 4.800 N RASSF3 n/a
3 TRCN0000436094 GTAGCAATGGCTGTATGAATA pLKO_005 452 CDS 100% 13.200 9.240 N RASSF3 n/a
4 TRCN0000433269 TACAGATGGAACTCTGCAAAC pLKO_005 392 CDS 100% 6.000 4.200 N RASSF3 n/a
5 TRCN0000428171 CACAGACTTCTCCAAATTCTG pLKO_005 416 CDS 100% 4.950 3.465 N RASSF3 n/a
6 TRCN0000077899 CGGCCAACAAGATGTTGAGAA pLKO.1 240 CDS 100% 4.950 3.465 N RASSF3 n/a
7 TRCN0000077902 GAGATCAAAGAGAAAGTTCAT pLKO.1 295 CDS 100% 4.950 3.465 N RASSF3 n/a
8 TRCN0000431608 TAGCAGTCACAGACAAGTTGA pLKO_005 326 CDS 100% 4.950 3.465 N RASSF3 n/a
9 TRCN0000417538 AGAACCTGAAGAGGCGCTACA pLKO_005 779 CDS 100% 4.050 2.835 N RASSF3 n/a
10 TRCN0000419434 TTGCACTTTATAAGCGTTGTC pLKO_005 560 CDS 100% 4.050 2.835 N RASSF3 n/a
11 TRCN0000077901 CCTTGAATTCAAATGGGATTT pLKO.1 353 CDS 100% 0.000 0.000 N RASSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178169.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09941 pDONR223 100% 99.7% 99.5% None 108A>G;698A>T n/a
2 ccsbBroad304_09941 pLX_304 0% 99.7% 99.5% V5 108A>G;698A>T n/a
3 TRCN0000477958 ACATATCTGCATCAGTTGGTCCTC pLX_317 66.7% 99.7% 99.5% V5 108A>G;698A>T n/a
4 ccsbBroadEn_13498 pDONR223 100% 70.5% 70.5% None 1_210del n/a
5 ccsbBroad304_13498 pLX_304 0% 70.5% 70.5% V5 1_210del n/a
6 TRCN0000481294 GAGGTCCCAGATATCTCGGGACAC pLX_317 98.8% 70.5% 70.5% V5 1_210del n/a
Download CSV