Transcript: Human NM_178190.3

Homo sapiens ATP synthase inhibitory factor subunit 1 (ATP5IF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ATP5IF1 (93974)
Length:
579
CDS:
61..276

Additional Resources:

NCBI RefSeq record:
NM_178190.3
NBCI Gene record:
ATP5IF1 (93974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421295 ATCAGTCCGAGAATGTCGACC pLKO_005 143 CDS 100% 2.160 3.024 N ATP5IF1 n/a
2 TRCN0000149051 GAAGAGGAACGATATTTCCGA pLKO.1 220 CDS 100% 0.750 1.050 N ATP5IF1 n/a
3 TRCN0000148922 CGCCATAAGCAGAAGATCAAA pLKO.1 416 3UTR 100% 5.625 4.500 N ATP5IF1 n/a
4 TRCN0000149949 GAGCGTCTGCAGAAAGAAATT pLKO.1 392 3UTR 100% 13.200 9.240 N ATP5IF1 n/a
5 TRCN0000147448 GAAAGAAATTGAGCGCCATAA pLKO.1 403 3UTR 100% 10.800 7.560 N ATP5IF1 n/a
6 TRCN0000432890 GAGCACAGAGTAGAGAACAAC pLKO_005 315 3UTR 100% 4.950 3.465 N ATP5IF1 n/a
7 TRCN0000146646 CCATGAAGAAGAAATCGTTCA pLKO.1 355 3UTR 100% 4.050 2.835 N ATP5IF1 n/a
8 TRCN0000146647 CGTTCATCATAAGAAGGAGAT pLKO.1 370 3UTR 100% 4.050 2.835 N ATP5IF1 n/a
9 TRCN0000415006 GAAAGAGAGAGCAGGCTGAAG pLKO_005 203 CDS 100% 4.050 2.835 N ATP5IF1 n/a
10 TRCN0000150110 CACCATGAAGAAGAAATCGTT pLKO.1 353 3UTR 100% 3.000 2.100 N ATP5IF1 n/a
11 TRCN0000415769 AGGAGATTGAGCGTCTGCAGA pLKO_005 384 3UTR 100% 2.640 1.848 N ATP5IF1 n/a
12 TRCN0000149594 CAGAAAGAAATTGAGCGCCAT pLKO.1 401 3UTR 100% 2.160 1.512 N ATP5IF1 n/a
13 TRCN0000414595 GTAGAGAACAACTGGCAGCTT pLKO_005 324 3UTR 100% 2.640 1.584 N ATP5IF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04610 pDONR223 100% 84% 84.5% None 180_213delinsG n/a
2 ccsbBroad304_04610 pLX_304 0% 84% 84.5% V5 180_213delinsG n/a
3 TRCN0000468859 GCCAGCCCCGGATATGAGTTTTTT pLX_317 100% 84% 84.5% V5 180_213delinsG n/a
4 ccsbBroadEn_04609 pDONR223 100% 63.2% 61.3% None (many diffs) n/a
5 ccsbBroad304_04609 pLX_304 0% 63.2% 61.3% V5 (many diffs) n/a
6 TRCN0000468794 AAGTTTACCTAGTGCCACTCTCTA pLX_317 100% 63.2% 61.3% V5 (many diffs) n/a
Download CSV